\
| Variant ID: vg0113723567 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 13723567 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CTAATTGTACTCTATTATCAATTTGTTATTGTGTGCCTCAGCTGATTCCTGGACGAGGGTTCACACACATGTAAGCGTTTGGAATTTTGGATAGAAATTC[C/T]
GGGCGTGACACCTTTCACGAAATTGGTGTAATTTTGCTACTTTATCTCTTTTGTGCCTCCACCACATCTGTCACCGCCGAGACCGAAGGAAGGGGAAAAA
TTTTTCCCCTTCCTTCGGTCTCGGCGGTGACAGATGTGGTGGAGGCACAAAAGAGATAAAGTAGCAAAATTACACCAATTTCGTGAAAGGTGTCACGCCC[G/A]
GAATTTCTATCCAAAATTCCAAACGCTTACATGTGTGTGAACCCTCGTCCAGGAATCAGCTGAGGCACACAATAACAAATTGATAATAGAGTACAATTAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 81.90% | 0.60% | 3.20% | 14.30% | NA |
| All Indica | 2759 | 73.90% | 0.10% | 4.64% | 21.35% | NA |
| All Japonica | 1512 | 95.70% | 1.50% | 1.19% | 1.59% | NA |
| Aus | 269 | 98.50% | 0.40% | 0.37% | 0.74% | NA |
| Indica I | 595 | 70.40% | 0.20% | 6.05% | 23.36% | NA |
| Indica II | 465 | 55.70% | 0.00% | 3.01% | 41.29% | NA |
| Indica III | 913 | 83.40% | 0.10% | 4.82% | 11.72% | NA |
| Indica Intermediate | 786 | 76.50% | 0.00% | 4.33% | 19.21% | NA |
| Temperate Japonica | 767 | 96.50% | 2.20% | 1.30% | 0.00% | NA |
| Tropical Japonica | 504 | 95.20% | 0.00% | 0.40% | 4.37% | NA |
| Japonica Intermediate | 241 | 94.20% | 2.50% | 2.49% | 0.83% | NA |
| VI/Aromatic | 96 | 47.90% | 1.00% | 4.17% | 46.88% | NA |
| Intermediate | 90 | 82.20% | 0.00% | 0.00% | 17.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0113723567 | C -> T | LOC_Os01g24350.1 | downstream_gene_variant ; 4024.0bp to feature; MODIFIER | silent_mutation | Average:19.726; most accessible tissue: Callus, score: 40.769 | N | N | N | N |
| vg0113723567 | C -> T | LOC_Os01g24360.1 | downstream_gene_variant ; 3195.0bp to feature; MODIFIER | silent_mutation | Average:19.726; most accessible tissue: Callus, score: 40.769 | N | N | N | N |
| vg0113723567 | C -> T | LOC_Os01g24350-LOC_Os01g24360 | intergenic_region ; MODIFIER | silent_mutation | Average:19.726; most accessible tissue: Callus, score: 40.769 | N | N | N | N |
| vg0113723567 | C -> DEL | N | N | silent_mutation | Average:19.726; most accessible tissue: Callus, score: 40.769 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0113723567 | NA | 3.05E-06 | mr1100 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113723567 | NA | 4.44E-06 | mr1203 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113723567 | NA | 6.10E-07 | mr1613 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113723567 | 2.40E-07 | NA | mr1754 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113723567 | NA | 2.73E-06 | mr1829 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113723567 | NA | 8.59E-06 | mr1100_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113723567 | NA | 1.61E-06 | mr1613_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113723567 | NA | 9.05E-06 | mr1829_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113723567 | NA | 8.55E-06 | mr1842_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113723567 | NA | 2.30E-06 | mr1913_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |