\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0113723567:

Variant ID: vg0113723567 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 13723567
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTAATTGTACTCTATTATCAATTTGTTATTGTGTGCCTCAGCTGATTCCTGGACGAGGGTTCACACACATGTAAGCGTTTGGAATTTTGGATAGAAATTC[C/T]
GGGCGTGACACCTTTCACGAAATTGGTGTAATTTTGCTACTTTATCTCTTTTGTGCCTCCACCACATCTGTCACCGCCGAGACCGAAGGAAGGGGAAAAA

Reverse complement sequence

TTTTTCCCCTTCCTTCGGTCTCGGCGGTGACAGATGTGGTGGAGGCACAAAAGAGATAAAGTAGCAAAATTACACCAATTTCGTGAAAGGTGTCACGCCC[G/A]
GAATTTCTATCCAAAATTCCAAACGCTTACATGTGTGTGAACCCTCGTCCAGGAATCAGCTGAGGCACACAATAACAAATTGATAATAGAGTACAATTAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.90% 0.60% 3.20% 14.30% NA
All Indica  2759 73.90% 0.10% 4.64% 21.35% NA
All Japonica  1512 95.70% 1.50% 1.19% 1.59% NA
Aus  269 98.50% 0.40% 0.37% 0.74% NA
Indica I  595 70.40% 0.20% 6.05% 23.36% NA
Indica II  465 55.70% 0.00% 3.01% 41.29% NA
Indica III  913 83.40% 0.10% 4.82% 11.72% NA
Indica Intermediate  786 76.50% 0.00% 4.33% 19.21% NA
Temperate Japonica  767 96.50% 2.20% 1.30% 0.00% NA
Tropical Japonica  504 95.20% 0.00% 0.40% 4.37% NA
Japonica Intermediate  241 94.20% 2.50% 2.49% 0.83% NA
VI/Aromatic  96 47.90% 1.00% 4.17% 46.88% NA
Intermediate  90 82.20% 0.00% 0.00% 17.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0113723567 C -> T LOC_Os01g24350.1 downstream_gene_variant ; 4024.0bp to feature; MODIFIER silent_mutation Average:19.726; most accessible tissue: Callus, score: 40.769 N N N N
vg0113723567 C -> T LOC_Os01g24360.1 downstream_gene_variant ; 3195.0bp to feature; MODIFIER silent_mutation Average:19.726; most accessible tissue: Callus, score: 40.769 N N N N
vg0113723567 C -> T LOC_Os01g24350-LOC_Os01g24360 intergenic_region ; MODIFIER silent_mutation Average:19.726; most accessible tissue: Callus, score: 40.769 N N N N
vg0113723567 C -> DEL N N silent_mutation Average:19.726; most accessible tissue: Callus, score: 40.769 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0113723567 NA 3.05E-06 mr1100 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113723567 NA 4.44E-06 mr1203 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113723567 NA 6.10E-07 mr1613 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113723567 2.40E-07 NA mr1754 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113723567 NA 2.73E-06 mr1829 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113723567 NA 8.59E-06 mr1100_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113723567 NA 1.61E-06 mr1613_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113723567 NA 9.05E-06 mr1829_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113723567 NA 8.55E-06 mr1842_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113723567 NA 2.30E-06 mr1913_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251