\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0113689599:

Variant ID: vg0113689599 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 13689599
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.87, T: 0.13, others allele: 0.00, population size: 78. )

Flanking Sequence (100 bp) in Reference Genome:


AAATTATTACCACAATCCGAACCATCTCTTGGCTCAGCTATACATGATATTGCACTATCATCTAAACTAGCATTTAAACTATTATCATCCACTTGGCTTT[T/C]
CTGAGCCAGAGCTTCATGCAACACATGATCAACATCAAGAAATATTTGGCCATTTAATTTCTCTTTAATAGAATCAAGCAATCCATCATATGCAATGTTG

Reverse complement sequence

CAACATTGCATATGATGGATTGCTTGATTCTATTAAAGAGAAATTAAATGGCCAAATATTTCTTGATGTTGATCATGTGTTGCATGAAGCTCTGGCTCAG[A/G]
AAAGCCAAGTGGATGATAATAGTTTAAATGCTAGTTTAGATGATAGTGCAATATCATGTATAGCTGAGCCAAGAGATGGTTCGGATTGTGGTAATAATTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.80% 32.80% 7.81% 1.63% NA
All Indica  2759 83.20% 7.40% 9.31% 0.07% NA
All Japonica  1512 5.10% 83.90% 6.22% 4.83% NA
Aus  269 97.00% 2.20% 0.74% 0.00% NA
Indica I  595 80.20% 4.20% 15.63% 0.00% NA
Indica II  465 88.60% 6.90% 4.30% 0.22% NA
Indica III  913 79.30% 11.10% 9.64% 0.00% NA
Indica Intermediate  786 86.80% 6.00% 7.12% 0.13% NA
Temperate Japonica  767 2.00% 96.90% 0.52% 0.65% NA
Tropical Japonica  504 10.90% 60.30% 16.07% 12.70% NA
Japonica Intermediate  241 2.90% 91.70% 3.73% 1.66% NA
VI/Aromatic  96 61.50% 29.20% 9.38% 0.00% NA
Intermediate  90 44.40% 45.60% 7.78% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0113689599 T -> DEL LOC_Os01g24294.1 N frameshift_variant Average:12.049; most accessible tissue: Zhenshan97 root, score: 16.934 N N N N
vg0113689599 T -> C LOC_Os01g24294.1 missense_variant ; p.Lys938Glu; MODERATE nonsynonymous_codon ; K938E Average:12.049; most accessible tissue: Zhenshan97 root, score: 16.934 benign -0.011 TOLERATED 1.00

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0113689599 NA 1.64E-21 mr1102 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113689599 NA 2.02E-14 mr1218 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113689599 NA 3.38E-26 mr1223 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113689599 NA 2.46E-28 mr1298 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113689599 4.59E-06 NA mr1301 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113689599 NA 2.07E-23 mr1383 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113689599 NA 3.07E-27 mr1414 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113689599 NA 3.40E-34 mr1448 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113689599 NA 2.70E-41 mr1480 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113689599 NA 3.05E-35 mr1533 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113689599 NA 9.19E-41 mr1601 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113689599 NA 3.01E-06 mr1602 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113689599 NA 4.73E-30 mr1638 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113689599 NA 2.38E-06 mr1646 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113689599 NA 2.39E-15 mr1653 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113689599 NA 4.78E-73 mr1778 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113689599 NA 1.26E-08 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113689599 NA 1.27E-13 mr1909 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113689599 NA 3.07E-10 mr1921 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113689599 NA 7.82E-63 mr1125_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113689599 NA 7.96E-57 mr1136_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113689599 NA 2.56E-21 mr1175_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113689599 NA 4.10E-28 mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113689599 NA 1.02E-38 mr1448_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113689599 NA 1.14E-25 mr1484_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113689599 NA 1.00E-24 mr1653_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113689599 NA 6.06E-18 mr1712_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113689599 NA 9.24E-13 mr1717_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113689599 NA 6.66E-13 mr1770_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113689599 NA 1.34E-33 mr1780_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113689599 NA 3.92E-18 mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251