Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0113689599:

Variant ID: vg0113689599 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 13689599
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.87, T: 0.13, others allele: 0.00, population size: 78. )

Flanking Sequence (100 bp) in Reference Genome:

AAATTATTACCACAATCCGAACCATCTCTTGGCTCAGCTATACATGATATTGCACTATCATCTAAACTAGCATTTAAACTATTATCATCCACTTGGCTTT[T/C]
CTGAGCCAGAGCTTCATGCAACACATGATCAACATCAAGAAATATTTGGCCATTTAATTTCTCTTTAATAGAATCAAGCAATCCATCATATGCAATGTTG

Reverse complement sequence

CAACATTGCATATGATGGATTGCTTGATTCTATTAAAGAGAAATTAAATGGCCAAATATTTCTTGATGTTGATCATGTGTTGCATGAAGCTCTGGCTCAG[A/G]
AAAGCCAAGTGGATGATAATAGTTTAAATGCTAGTTTAGATGATAGTGCAATATCATGTATAGCTGAGCCAAGAGATGGTTCGGATTGTGGTAATAATTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	57.80%	32.80%	7.81%	1.63%	NA
All Indica	2759	83.20%	7.40%	9.31%	0.07%	NA
All Japonica	1512	5.10%	83.90%	6.22%	4.83%	NA
Aus	269	97.00%	2.20%	0.74%	0.00%	NA
Indica I	595	80.20%	4.20%	15.63%	0.00%	NA
Indica II	465	88.60%	6.90%	4.30%	0.22%	NA
Indica III	913	79.30%	11.10%	9.64%	0.00%	NA
Indica Intermediate	786	86.80%	6.00%	7.12%	0.13%	NA
Temperate Japonica	767	2.00%	96.90%	0.52%	0.65%	NA
Tropical Japonica	504	10.90%	60.30%	16.07%	12.70%	NA
Japonica Intermediate	241	2.90%	91.70%	3.73%	1.66%	NA
VI/Aromatic	96	61.50%	29.20%	9.38%	0.00%	NA
Intermediate	90	44.40%	45.60%	7.78%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0113689599	T -> DEL	LOC_Os01g24294.1	N	frameshift_variant	Average:12.049; most accessible tissue: Zhenshan97 root, score: 16.934	N	N	N	N
vg0113689599	T -> C	LOC_Os01g24294.1	missense_variant ; p.Lys938Glu; MODERATE	nonsynonymous_codon ; K938E	Average:12.049; most accessible tissue: Zhenshan97 root, score: 16.934	benign	-0.011	TOLERATED	1.00

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0113689599	NA	1.64E-21	mr1102	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113689599	NA	2.02E-14	mr1218	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113689599	NA	3.38E-26	mr1223	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113689599	NA	2.46E-28	mr1298	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113689599	4.59E-06	NA	mr1301	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113689599	NA	2.07E-23	mr1383	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113689599	NA	3.07E-27	mr1414	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113689599	NA	3.40E-34	mr1448	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113689599	NA	2.70E-41	mr1480	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113689599	NA	3.05E-35	mr1533	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113689599	NA	9.19E-41	mr1601	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113689599	NA	3.01E-06	mr1602	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113689599	NA	4.73E-30	mr1638	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113689599	NA	2.38E-06	mr1646	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113689599	NA	2.39E-15	mr1653	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113689599	NA	4.78E-73	mr1778	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113689599	NA	1.26E-08	mr1866	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113689599	NA	1.27E-13	mr1909	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113689599	NA	3.07E-10	mr1921	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113689599	NA	7.82E-63	mr1125_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113689599	NA	7.96E-57	mr1136_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113689599	NA	2.56E-21	mr1175_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113689599	NA	4.10E-28	mr1238_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113689599	NA	1.02E-38	mr1448_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113689599	NA	1.14E-25	mr1484_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113689599	NA	1.00E-24	mr1653_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113689599	NA	6.06E-18	mr1712_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113689599	NA	9.24E-13	mr1717_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113689599	NA	6.66E-13	mr1770_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113689599	NA	1.34E-33	mr1780_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113689599	NA	3.92E-18	mr1945_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251