\
| Variant ID: vg0113687946 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 13687946 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.88, T: 0.12, others allele: 0.00, population size: 82. )
TTCGGCTGTGGTTATTTTCCAGGAGCTAAACAATGATTCTTTATATTTTTGGTCGAAGTGGAAGCTCCTATGTTGCTCTCAATTTTCCCACTCTTCTCCA[T/A]
TGCCCCCCGGTCAGACCGGCCACTGAGCCCGGTCAGACCGGCCACAAGCCGTCGGTCAGACCGGCCAGTAAGGTCGGTCAGACCGGCCGTAGATTGGCGG
CCGCCAATCTACGGCCGGTCTGACCGACCTTACTGGCCGGTCTGACCGACGGCTTGTGGCCGGTCTGACCGGGCTCAGTGGCCGGTCTGACCGGGGGGCA[A/T]
TGGAGAAGAGTGGGAAAATTGAGAGCAACATAGGAGCTTCCACTTCGACCAAAAATATAAAGAATCATTGTTTAGCTCCTGGAAAATAACCACAGCCGAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 39.30% | 38.80% | 13.31% | 8.61% | NA |
| All Indica | 2759 | 56.80% | 17.30% | 19.64% | 6.23% | NA |
| All Japonica | 1512 | 3.80% | 84.70% | 2.58% | 8.99% | NA |
| Aus | 269 | 49.10% | 5.20% | 15.24% | 30.48% | NA |
| Indica I | 595 | 30.80% | 24.40% | 26.55% | 18.32% | NA |
| Indica II | 465 | 88.00% | 8.80% | 2.58% | 0.65% | NA |
| Indica III | 913 | 58.70% | 15.30% | 23.00% | 2.96% | NA |
| Indica Intermediate | 786 | 55.90% | 19.30% | 20.61% | 4.20% | NA |
| Temperate Japonica | 767 | 0.30% | 96.90% | 1.69% | 1.17% | NA |
| Tropical Japonica | 504 | 9.90% | 64.90% | 3.57% | 21.63% | NA |
| Japonica Intermediate | 241 | 2.10% | 87.10% | 3.32% | 7.47% | NA |
| VI/Aromatic | 96 | 66.70% | 22.90% | 3.12% | 7.29% | NA |
| Intermediate | 90 | 38.90% | 45.60% | 4.44% | 11.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0113687946 | T -> A | LOC_Os01g24294.1 | intron_variant ; MODIFIER | silent_mutation | Average:24.389; most accessible tissue: Minghui63 young leaf, score: 43.347 | N | N | N | N |
| vg0113687946 | T -> DEL | N | N | silent_mutation | Average:24.389; most accessible tissue: Minghui63 young leaf, score: 43.347 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0113687946 | NA | 1.67E-06 | mr1064 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113687946 | NA | 5.46E-06 | mr1136 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113687946 | NA | 4.40E-06 | mr1215 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113687946 | NA | 2.53E-06 | mr1304 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113687946 | NA | 6.19E-18 | mr1557 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113687946 | 4.01E-06 | 4.01E-06 | mr1601 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113687946 | NA | 7.06E-12 | mr1741 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113687946 | NA | 5.52E-08 | mr1741 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113687946 | NA | 2.56E-08 | mr1819 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113687946 | NA | 4.59E-06 | mr1884 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113687946 | NA | 2.78E-06 | mr1887 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113687946 | NA | 1.06E-06 | mr1124_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |