Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0113686887:

Variant ID: vg0113686887 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 13686887
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:

TTATAACCAAATGCTTAGTGTATCAAACTATTGGACCAAAATCCCTCCTCTCTAGACATATGAAAAATTATAACATCCAACTAACATGTCTAGATGAATA[T/C]
TAATTCAAATGGCTTTTGAAACAATAATCATCATGGCATCAAAACACTTAGCCAATTGAAGTATGATCAATAATGAATCACCAAAGTCATATGTGTCACA

Reverse complement sequence

TGTGACACATATGACTTTGGTGATTCATTATTGATCATACTTCAATTGGCTAAGTGTTTTGATGCCATGATGATTATTGTTTCAAAAGCCATTTGAATTA[A/G]
TATTCATCTAGACATGTTAGTTGGATGTTATAATTTTTCATATGTCTAGAGAGGAGGGATTTTGGTCCAATAGTTTGATACACTAAGCATTTGGTTATAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.80%	35.30%	2.18%	8.74%	NA
All Indica	2759	85.20%	9.60%	1.67%	3.44%	NA
All Japonica	1512	2.10%	86.60%	1.92%	9.39%	NA
Aus	269	21.20%	10.80%	5.95%	62.08%	NA
Indica I	595	74.30%	18.70%	1.51%	5.55%	NA
Indica II	465	90.50%	4.90%	2.37%	2.15%	NA
Indica III	913	92.70%	3.60%	1.64%	2.08%	NA
Indica Intermediate	786	81.80%	12.60%	1.40%	4.20%	NA
Temperate Japonica	767	0.80%	97.80%	0.00%	1.43%	NA
Tropical Japonica	504	4.60%	66.70%	4.96%	23.81%	NA
Japonica Intermediate	241	1.20%	92.50%	1.66%	4.56%	NA
VI/Aromatic	96	62.50%	27.10%	10.42%	0.00%	NA
Intermediate	90	46.70%	41.10%	2.22%	10.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0113686887	T -> DEL	N	N	silent_mutation	Average:16.381; most accessible tissue: Zhenshan97 flag leaf, score: 30.355	N	N	N	N
vg0113686887	T -> C	LOC_Os01g24294.1	intron_variant ; MODIFIER	silent_mutation	Average:16.381; most accessible tissue: Zhenshan97 flag leaf, score: 30.355	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0113686887	NA	2.19E-42	mr1136	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113686887	NA	4.73E-11	mr1175	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113686887	NA	6.05E-06	mr1188	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113686887	NA	2.53E-10	mr1316	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113686887	NA	3.48E-31	mr1448	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113686887	NA	1.94E-07	mr1741	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113686887	3.23E-06	NA	mr1136_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113686887	NA	8.00E-06	mr1457_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113686887	NA	6.07E-09	mr1458_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251