\
| Variant ID: vg0113669976 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 13669976 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
GTATTTAATTTCATTCCTACTTTCTCAAATCATGCCATTGTTATCATGGCAATGTGGCGCTCACGTCTCCACATGCCGCATCTCAATTATCTTCCCAAAG[A/G]
TAATTGCCCCAAACATATAGCATTTGATAAAATATGAGTGTGCATAAGTCTAGAATAGCAGTTCTAAGCAAGTGTCATAATTGACTAAGGACTAATACGT
ACGTATTAGTCCTTAGTCAATTATGACACTTGCTTAGAACTGCTATTCTAGACTTATGCACACTCATATTTTATCAAATGCTATATGTTTGGGGCAATTA[T/C]
CTTTGGGAAGATAATTGAGATGCGGCATGTGGAGACGTGAGCGCCACATTGCCATGATAACAATGGCATGATTTGAGAAAGTAGGAATGAAATTAAATAC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 32.20% | 0.60% | 24.14% | 43.08% | NA |
| All Indica | 2759 | 6.50% | 0.90% | 37.15% | 55.45% | NA |
| All Japonica | 1512 | 83.70% | 0.00% | 0.40% | 15.94% | NA |
| Aus | 269 | 2.20% | 0.70% | 34.94% | 62.08% | NA |
| Indica I | 595 | 7.20% | 0.50% | 20.67% | 71.60% | NA |
| Indica II | 465 | 7.10% | 1.30% | 18.06% | 73.55% | NA |
| Indica III | 913 | 6.90% | 0.70% | 56.19% | 36.25% | NA |
| Indica Intermediate | 786 | 5.20% | 1.10% | 38.80% | 54.83% | NA |
| Temperate Japonica | 767 | 97.00% | 0.00% | 0.52% | 2.48% | NA |
| Tropical Japonica | 504 | 59.50% | 0.00% | 0.20% | 40.28% | NA |
| Japonica Intermediate | 241 | 91.70% | 0.00% | 0.41% | 7.88% | NA |
| VI/Aromatic | 96 | 30.20% | 0.00% | 8.33% | 61.46% | NA |
| Intermediate | 90 | 46.70% | 1.10% | 8.89% | 43.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0113669976 | A -> G | LOC_Os01g24270.1 | upstream_gene_variant ; 2160.0bp to feature; MODIFIER | silent_mutation | Average:25.653; most accessible tissue: Callus, score: 48.316 | N | N | N | N |
| vg0113669976 | A -> G | LOC_Os01g24260.1 | intron_variant ; MODIFIER | silent_mutation | Average:25.653; most accessible tissue: Callus, score: 48.316 | N | N | N | N |
| vg0113669976 | A -> DEL | N | N | silent_mutation | Average:25.653; most accessible tissue: Callus, score: 48.316 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0113669976 | NA | 1.97E-06 | mr1543 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113669976 | 7.42E-06 | 7.42E-06 | mr1711 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113669976 | 3.23E-06 | 6.77E-08 | mr1871 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113669976 | NA | 3.03E-07 | mr1042_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113669976 | 6.30E-08 | 5.08E-10 | mr1543_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113669976 | 7.38E-06 | NA | mr1742_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113669976 | 3.47E-09 | 1.95E-11 | mr1742_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113669976 | 1.24E-06 | 4.29E-08 | mr1871_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |