\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0113669976:

Variant ID: vg0113669976 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 13669976
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTATTTAATTTCATTCCTACTTTCTCAAATCATGCCATTGTTATCATGGCAATGTGGCGCTCACGTCTCCACATGCCGCATCTCAATTATCTTCCCAAAG[A/G]
TAATTGCCCCAAACATATAGCATTTGATAAAATATGAGTGTGCATAAGTCTAGAATAGCAGTTCTAAGCAAGTGTCATAATTGACTAAGGACTAATACGT

Reverse complement sequence

ACGTATTAGTCCTTAGTCAATTATGACACTTGCTTAGAACTGCTATTCTAGACTTATGCACACTCATATTTTATCAAATGCTATATGTTTGGGGCAATTA[T/C]
CTTTGGGAAGATAATTGAGATGCGGCATGTGGAGACGTGAGCGCCACATTGCCATGATAACAATGGCATGATTTGAGAAAGTAGGAATGAAATTAAATAC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 32.20% 0.60% 24.14% 43.08% NA
All Indica  2759 6.50% 0.90% 37.15% 55.45% NA
All Japonica  1512 83.70% 0.00% 0.40% 15.94% NA
Aus  269 2.20% 0.70% 34.94% 62.08% NA
Indica I  595 7.20% 0.50% 20.67% 71.60% NA
Indica II  465 7.10% 1.30% 18.06% 73.55% NA
Indica III  913 6.90% 0.70% 56.19% 36.25% NA
Indica Intermediate  786 5.20% 1.10% 38.80% 54.83% NA
Temperate Japonica  767 97.00% 0.00% 0.52% 2.48% NA
Tropical Japonica  504 59.50% 0.00% 0.20% 40.28% NA
Japonica Intermediate  241 91.70% 0.00% 0.41% 7.88% NA
VI/Aromatic  96 30.20% 0.00% 8.33% 61.46% NA
Intermediate  90 46.70% 1.10% 8.89% 43.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0113669976 A -> G LOC_Os01g24270.1 upstream_gene_variant ; 2160.0bp to feature; MODIFIER silent_mutation Average:25.653; most accessible tissue: Callus, score: 48.316 N N N N
vg0113669976 A -> G LOC_Os01g24260.1 intron_variant ; MODIFIER silent_mutation Average:25.653; most accessible tissue: Callus, score: 48.316 N N N N
vg0113669976 A -> DEL N N silent_mutation Average:25.653; most accessible tissue: Callus, score: 48.316 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0113669976 NA 1.97E-06 mr1543 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113669976 7.42E-06 7.42E-06 mr1711 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113669976 3.23E-06 6.77E-08 mr1871 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113669976 NA 3.03E-07 mr1042_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113669976 6.30E-08 5.08E-10 mr1543_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113669976 7.38E-06 NA mr1742_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113669976 3.47E-09 1.95E-11 mr1742_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113669976 1.24E-06 4.29E-08 mr1871_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251