Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0113652030:

Variant ID: vg0113652030 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 13652030
Reference Allele: G	Alternative Allele: A,C
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 58. )

Flanking Sequence (100 bp) in Reference Genome:

CGAGTCAAAAGTGATTTTCACGTGCCGGGTCTACGAAAATCGCTATTTTTCCATACGGGTGACCCACACGCCACGAAAATCCCATTTTTTCCGTACAGGT[G/A,C]
CTTCTGTCGTCCACACGCAAAAATAAAAAATCTGAAAAGAAAATCGCAAAATGCTAGCTGGTCGGGCTCTCCTGCTACTGGTCAGGGCAGGGGACGGCCG

Reverse complement sequence

CGGCCGTCCCCTGCCCTGACCAGTAGCAGGAGAGCCCGACCAGCTAGCATTTTGCGATTTTCTTTTCAGATTTTTTATTTTTGCGTGTGGACGACAGAAG[C/T,G]
ACCTGTACGGAAAAAATGGGATTTTCGTGGCGTGTGGGTCACCCGTATGGAAAAATAGCGATTTTCGTAGACCCGGCACGTGAAAATCACTTTTGACTCG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	36.70%	4.70%	0.59%	58.04%	C: 0.02%
All Indica	2759	13.90%	7.90%	0.83%	77.35%	NA
All Japonica	1512	84.10%	0.00%	0.20%	15.67%	C: 0.07%
Aus	269	1.50%	0.00%	0.00%	98.51%	NA
Indica I	595	4.50%	25.90%	2.02%	67.56%	NA
Indica II	465	8.40%	4.70%	1.29%	85.59%	NA
Indica III	913	24.10%	0.30%	0.22%	75.36%	NA
Indica Intermediate	786	12.30%	5.10%	0.38%	82.19%	NA
Temperate Japonica	767	97.10%	0.00%	0.13%	2.74%	NA
Tropical Japonica	504	60.50%	0.00%	0.40%	38.89%	C: 0.20%
Japonica Intermediate	241	91.70%	0.00%	0.00%	8.30%	NA
VI/Aromatic	96	32.30%	0.00%	1.04%	66.67%	NA
Intermediate	90	48.90%	2.20%	1.11%	47.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0113652030	G -> A	LOC_Os01g24220.1	downstream_gene_variant ; 1551.0bp to feature; MODIFIER	silent_mutation	Average:33.668; most accessible tissue: Zhenshan97 panicle, score: 69.946	N	N	N	N
vg0113652030	G -> A	LOC_Os01g24230.1	downstream_gene_variant ; 3776.0bp to feature; MODIFIER	silent_mutation	Average:33.668; most accessible tissue: Zhenshan97 panicle, score: 69.946	N	N	N	N
vg0113652030	G -> A	LOC_Os01g24220-LOC_Os01g24230	intergenic_region ; MODIFIER	silent_mutation	Average:33.668; most accessible tissue: Zhenshan97 panicle, score: 69.946	N	N	N	N
vg0113652030	G -> DEL	N	N	silent_mutation	Average:33.668; most accessible tissue: Zhenshan97 panicle, score: 69.946	N	N	N	N
vg0113652030	G -> C	LOC_Os01g24220.1	downstream_gene_variant ; 1551.0bp to feature; MODIFIER	silent_mutation	Average:33.668; most accessible tissue: Zhenshan97 panicle, score: 69.946	N	N	N	N
vg0113652030	G -> C	LOC_Os01g24230.1	downstream_gene_variant ; 3776.0bp to feature; MODIFIER	silent_mutation	Average:33.668; most accessible tissue: Zhenshan97 panicle, score: 69.946	N	N	N	N
vg0113652030	G -> C	LOC_Os01g24220-LOC_Os01g24230	intergenic_region ; MODIFIER	silent_mutation	Average:33.668; most accessible tissue: Zhenshan97 panicle, score: 69.946	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0113652030	6.59E-06	6.62E-06	mr1286_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113652030	1.64E-06	1.64E-06	mr1286_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113652030	8.88E-06	8.88E-06	mr1485_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113652030	5.10E-06	5.10E-06	mr1485_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113652030	NA	6.12E-06	mr1519_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113652030	3.40E-07	1.74E-06	mr1665_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113652030	9.83E-08	9.83E-08	mr1665_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113652030	2.96E-06	NA	mr1683_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113652030	3.82E-06	3.82E-06	mr1687_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113652030	7.16E-06	7.10E-06	mr1738_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113652030	8.81E-06	8.81E-06	mr1738_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113652030	NA	5.23E-06	mr1747_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113652030	7.24E-06	7.24E-06	mr1764_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113652030	8.81E-07	4.33E-06	mr1811_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113652030	4.50E-07	9.33E-07	mr1811_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113652030	8.28E-06	NA	mr1816_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113652030	2.11E-06	5.51E-06	mr1823_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113652030	7.30E-06	NA	mr1831_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113652030	6.58E-06	NA	mr1833_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113652030	4.15E-06	5.24E-06	mr1843_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113652030	5.88E-06	5.89E-06	mr1847_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113652030	7.02E-06	7.02E-06	mr1979_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251