\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0113615431:

Variant ID: vg0113615431 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 13615431
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGAAATCGACTATGGACACACAATGCAATTCCCCATATTTAAGTGCCAGTGGGTAAAATAACCGAACGGGGTCAATGTTGATATGTTTGGTCTTACTGTT[G/A]
TTGACCTTACGAGTGTGGGTCACAAGGATGACCCTTGGGTACTCACCAATCGCATGGCACAAGTGTTTTATGAGAAAGACCCTTCAAATTTGAAGAAAAC

Reverse complement sequence

GTTTTCTTCAAATTTGAAGGGTCTTTCTCATAAAACACTTGTGCCATGCGATTGGTGAGTACCCAAGGGTCATCCTTGTGACCCACACTCGTAAGGTCAA[C/T]
AACAGTAAGACCAAACATATCAACATTGACCCCGTTCGGTTATTTTACCCACTGGCACTTAAATATGGGGAATTGCATTGTGTGTCCATAGTCGATTTCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.10% 0.30% 4.04% 44.54% NA
All Indica  2759 33.60% 0.40% 4.28% 61.65% NA
All Japonica  1512 89.90% 0.10% 2.45% 7.47% NA
Aus  269 16.40% 0.00% 4.09% 79.55% NA
Indica I  595 56.80% 0.00% 0.50% 42.69% NA
Indica II  465 20.00% 0.20% 1.72% 78.06% NA
Indica III  913 26.40% 0.50% 8.76% 64.29% NA
Indica Intermediate  786 32.60% 0.80% 3.44% 63.23% NA
Temperate Japonica  767 99.00% 0.00% 0.26% 0.78% NA
Tropical Japonica  504 74.00% 0.40% 6.15% 19.44% NA
Japonica Intermediate  241 94.60% 0.00% 1.66% 3.73% NA
VI/Aromatic  96 31.20% 0.00% 21.88% 46.88% NA
Intermediate  90 60.00% 0.00% 4.44% 35.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0113615431 G -> A LOC_Os01g24150.1 upstream_gene_variant ; 2077.0bp to feature; MODIFIER silent_mutation Average:22.689; most accessible tissue: Callus, score: 59.024 N N N N
vg0113615431 G -> A LOC_Os01g24140.1 downstream_gene_variant ; 403.0bp to feature; MODIFIER silent_mutation Average:22.689; most accessible tissue: Callus, score: 59.024 N N N N
vg0113615431 G -> A LOC_Os01g24140-LOC_Os01g24150 intergenic_region ; MODIFIER silent_mutation Average:22.689; most accessible tissue: Callus, score: 59.024 N N N N
vg0113615431 G -> DEL N N silent_mutation Average:22.689; most accessible tissue: Callus, score: 59.024 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0113615431 8.21E-06 3.00E-08 mr1502 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113615431 9.71E-09 1.07E-11 mr1543 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113615431 NA 2.20E-07 mr1742 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113615431 8.68E-07 7.05E-10 mr1871 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113615431 NA 6.07E-07 mr1042_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113615431 4.47E-06 5.45E-09 mr1543_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113615431 1.19E-06 5.06E-10 mr1742_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113615431 NA 6.05E-06 mr1815_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113615431 NA 2.24E-08 mr1871_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251