\
| Variant ID: vg0113615431 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 13615431 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GGAAATCGACTATGGACACACAATGCAATTCCCCATATTTAAGTGCCAGTGGGTAAAATAACCGAACGGGGTCAATGTTGATATGTTTGGTCTTACTGTT[G/A]
TTGACCTTACGAGTGTGGGTCACAAGGATGACCCTTGGGTACTCACCAATCGCATGGCACAAGTGTTTTATGAGAAAGACCCTTCAAATTTGAAGAAAAC
GTTTTCTTCAAATTTGAAGGGTCTTTCTCATAAAACACTTGTGCCATGCGATTGGTGAGTACCCAAGGGTCATCCTTGTGACCCACACTCGTAAGGTCAA[C/T]
AACAGTAAGACCAAACATATCAACATTGACCCCGTTCGGTTATTTTACCCACTGGCACTTAAATATGGGGAATTGCATTGTGTGTCCATAGTCGATTTCC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.10% | 0.30% | 4.04% | 44.54% | NA |
| All Indica | 2759 | 33.60% | 0.40% | 4.28% | 61.65% | NA |
| All Japonica | 1512 | 89.90% | 0.10% | 2.45% | 7.47% | NA |
| Aus | 269 | 16.40% | 0.00% | 4.09% | 79.55% | NA |
| Indica I | 595 | 56.80% | 0.00% | 0.50% | 42.69% | NA |
| Indica II | 465 | 20.00% | 0.20% | 1.72% | 78.06% | NA |
| Indica III | 913 | 26.40% | 0.50% | 8.76% | 64.29% | NA |
| Indica Intermediate | 786 | 32.60% | 0.80% | 3.44% | 63.23% | NA |
| Temperate Japonica | 767 | 99.00% | 0.00% | 0.26% | 0.78% | NA |
| Tropical Japonica | 504 | 74.00% | 0.40% | 6.15% | 19.44% | NA |
| Japonica Intermediate | 241 | 94.60% | 0.00% | 1.66% | 3.73% | NA |
| VI/Aromatic | 96 | 31.20% | 0.00% | 21.88% | 46.88% | NA |
| Intermediate | 90 | 60.00% | 0.00% | 4.44% | 35.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0113615431 | G -> A | LOC_Os01g24150.1 | upstream_gene_variant ; 2077.0bp to feature; MODIFIER | silent_mutation | Average:22.689; most accessible tissue: Callus, score: 59.024 | N | N | N | N |
| vg0113615431 | G -> A | LOC_Os01g24140.1 | downstream_gene_variant ; 403.0bp to feature; MODIFIER | silent_mutation | Average:22.689; most accessible tissue: Callus, score: 59.024 | N | N | N | N |
| vg0113615431 | G -> A | LOC_Os01g24140-LOC_Os01g24150 | intergenic_region ; MODIFIER | silent_mutation | Average:22.689; most accessible tissue: Callus, score: 59.024 | N | N | N | N |
| vg0113615431 | G -> DEL | N | N | silent_mutation | Average:22.689; most accessible tissue: Callus, score: 59.024 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0113615431 | 8.21E-06 | 3.00E-08 | mr1502 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113615431 | 9.71E-09 | 1.07E-11 | mr1543 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113615431 | NA | 2.20E-07 | mr1742 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113615431 | 8.68E-07 | 7.05E-10 | mr1871 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113615431 | NA | 6.07E-07 | mr1042_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113615431 | 4.47E-06 | 5.45E-09 | mr1543_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113615431 | 1.19E-06 | 5.06E-10 | mr1742_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113615431 | NA | 6.05E-06 | mr1815_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113615431 | NA | 2.24E-08 | mr1871_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |