Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0113615431:

Variant ID: vg0113615431 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 13615431
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGAAATCGACTATGGACACACAATGCAATTCCCCATATTTAAGTGCCAGTGGGTAAAATAACCGAACGGGGTCAATGTTGATATGTTTGGTCTTACTGTT[G/A]
TTGACCTTACGAGTGTGGGTCACAAGGATGACCCTTGGGTACTCACCAATCGCATGGCACAAGTGTTTTATGAGAAAGACCCTTCAAATTTGAAGAAAAC

Reverse complement sequence

GTTTTCTTCAAATTTGAAGGGTCTTTCTCATAAAACACTTGTGCCATGCGATTGGTGAGTACCCAAGGGTCATCCTTGTGACCCACACTCGTAAGGTCAA[C/T]
AACAGTAAGACCAAACATATCAACATTGACCCCGTTCGGTTATTTTACCCACTGGCACTTAAATATGGGGAATTGCATTGTGTGTCCATAGTCGATTTCC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	51.10%	0.30%	4.04%	44.54%	NA
All Indica	2759	33.60%	0.40%	4.28%	61.65%	NA
All Japonica	1512	89.90%	0.10%	2.45%	7.47%	NA
Aus	269	16.40%	0.00%	4.09%	79.55%	NA
Indica I	595	56.80%	0.00%	0.50%	42.69%	NA
Indica II	465	20.00%	0.20%	1.72%	78.06%	NA
Indica III	913	26.40%	0.50%	8.76%	64.29%	NA
Indica Intermediate	786	32.60%	0.80%	3.44%	63.23%	NA
Temperate Japonica	767	99.00%	0.00%	0.26%	0.78%	NA
Tropical Japonica	504	74.00%	0.40%	6.15%	19.44%	NA
Japonica Intermediate	241	94.60%	0.00%	1.66%	3.73%	NA
VI/Aromatic	96	31.20%	0.00%	21.88%	46.88%	NA
Intermediate	90	60.00%	0.00%	4.44%	35.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0113615431	G -> A	LOC_Os01g24150.1	upstream_gene_variant ; 2077.0bp to feature; MODIFIER	silent_mutation	Average:22.689; most accessible tissue: Callus, score: 59.024	N	N	N	N
vg0113615431	G -> A	LOC_Os01g24140.1	downstream_gene_variant ; 403.0bp to feature; MODIFIER	silent_mutation	Average:22.689; most accessible tissue: Callus, score: 59.024	N	N	N	N
vg0113615431	G -> A	LOC_Os01g24140-LOC_Os01g24150	intergenic_region ; MODIFIER	silent_mutation	Average:22.689; most accessible tissue: Callus, score: 59.024	N	N	N	N
vg0113615431	G -> DEL	N	N	silent_mutation	Average:22.689; most accessible tissue: Callus, score: 59.024	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0113615431	8.21E-06	3.00E-08	mr1502	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113615431	9.71E-09	1.07E-11	mr1543	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113615431	NA	2.20E-07	mr1742	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113615431	8.68E-07	7.05E-10	mr1871	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113615431	NA	6.07E-07	mr1042_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113615431	4.47E-06	5.45E-09	mr1543_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113615431	1.19E-06	5.06E-10	mr1742_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113615431	NA	6.05E-06	mr1815_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113615431	NA	2.24E-08	mr1871_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251