Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0113601070:

Variant ID: vg0113601070 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 13601070
Reference Allele: A	Alternative Allele: T,C
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCCACAATCGCGTCCATCATGCGTAGTTGGGGACGCCATCAGTCCATCACTTTTGCGACATCACCTATCATCTACTACAGAATGGGTTTTTGCATACAGA[A/T,C]
GAACATGATCTTCGTATGTGGTCGGCCGGCCCGCATGCGCGAAATGGTCTGCAAAGATCATCATTTGCGTCCAGCCGCATGCGAAGATCGATCTTCGCAT

Reverse complement sequence

ATGCGAAGATCGATCTTCGCATGCGGCTGGACGCAAATGATGATCTTTGCAGACCATTTCGCGCATGCGGGCCGGCCGACCACATACGAAGATCATGTTC[T/A,G]
TCTGTATGCAAAAACCCATTCTGTAGTAGATGATAGGTGATGTCGCAAAAGTGATGGACTGATGGCGTCCCCAACTACGCATGATGGACGCGATTGTGGG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	38.90%	4.80%	0.72%	51.40%	T: 4.19%
All Indica	2759	15.80%	8.10%	0.94%	68.25%	T: 6.96%
All Japonica	1512	86.80%	0.00%	0.20%	13.03%	NA
Aus	269	7.80%	0.00%	1.49%	90.71%	NA
Indica I	595	29.10%	25.90%	1.51%	43.36%	T: 0.17%
Indica II	465	11.40%	4.70%	0.43%	83.23%	T: 0.22%
Indica III	913	7.20%	0.40%	0.66%	76.01%	T: 15.66%
Indica Intermediate	786	18.20%	5.50%	1.15%	69.21%	T: 5.98%
Temperate Japonica	767	98.80%	0.00%	0.00%	1.17%	NA
Tropical Japonica	504	65.30%	0.00%	0.60%	34.13%	NA
Japonica Intermediate	241	93.40%	0.00%	0.00%	6.64%	NA
VI/Aromatic	96	29.20%	0.00%	0.00%	69.79%	T: 1.04%
Intermediate	90	47.80%	3.30%	1.11%	42.22%	T: 5.56%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0113601070	A -> T	LOC_Os01g24120.1	downstream_gene_variant ; 2484.0bp to feature; MODIFIER	silent_mutation	Average:34.156; most accessible tissue: Callus, score: 91.302	N	N	N	N
vg0113601070	A -> T	LOC_Os01g24130.1	downstream_gene_variant ; 486.0bp to feature; MODIFIER	silent_mutation	Average:34.156; most accessible tissue: Callus, score: 91.302	N	N	N	N
vg0113601070	A -> T	LOC_Os01g24120-LOC_Os01g24130	intergenic_region ; MODIFIER	silent_mutation	Average:34.156; most accessible tissue: Callus, score: 91.302	N	N	N	N
vg0113601070	A -> DEL	N	N	silent_mutation	Average:34.156; most accessible tissue: Callus, score: 91.302	N	N	N	N
vg0113601070	A -> C	LOC_Os01g24120.1	downstream_gene_variant ; 2484.0bp to feature; MODIFIER	silent_mutation	Average:34.156; most accessible tissue: Callus, score: 91.302	N	N	N	N
vg0113601070	A -> C	LOC_Os01g24130.1	downstream_gene_variant ; 486.0bp to feature; MODIFIER	silent_mutation	Average:34.156; most accessible tissue: Callus, score: 91.302	N	N	N	N
vg0113601070	A -> C	LOC_Os01g24120-LOC_Os01g24130	intergenic_region ; MODIFIER	silent_mutation	Average:34.156; most accessible tissue: Callus, score: 91.302	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0113601070	NA	4.16E-06	mr1556_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113601070	NA	5.70E-06	mr1738_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113601070	4.74E-06	4.74E-06	mr1738_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113601070	2.91E-06	2.91E-06	mr1764_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113601070	5.81E-06	4.53E-06	mr1811_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113601070	3.36E-06	1.07E-06	mr1811_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113601070	7.47E-06	3.97E-06	mr1843_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113601070	4.20E-06	4.21E-06	mr1847_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251