\
| Variant ID: vg0113601070 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 13601070 |
| Reference Allele: A | Alternative Allele: T,C |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
CCCACAATCGCGTCCATCATGCGTAGTTGGGGACGCCATCAGTCCATCACTTTTGCGACATCACCTATCATCTACTACAGAATGGGTTTTTGCATACAGA[A/T,C]
GAACATGATCTTCGTATGTGGTCGGCCGGCCCGCATGCGCGAAATGGTCTGCAAAGATCATCATTTGCGTCCAGCCGCATGCGAAGATCGATCTTCGCAT
ATGCGAAGATCGATCTTCGCATGCGGCTGGACGCAAATGATGATCTTTGCAGACCATTTCGCGCATGCGGGCCGGCCGACCACATACGAAGATCATGTTC[T/A,G]
TCTGTATGCAAAAACCCATTCTGTAGTAGATGATAGGTGATGTCGCAAAAGTGATGGACTGATGGCGTCCCCAACTACGCATGATGGACGCGATTGTGGG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 38.90% | 4.80% | 0.72% | 51.40% | T: 4.19% |
| All Indica | 2759 | 15.80% | 8.10% | 0.94% | 68.25% | T: 6.96% |
| All Japonica | 1512 | 86.80% | 0.00% | 0.20% | 13.03% | NA |
| Aus | 269 | 7.80% | 0.00% | 1.49% | 90.71% | NA |
| Indica I | 595 | 29.10% | 25.90% | 1.51% | 43.36% | T: 0.17% |
| Indica II | 465 | 11.40% | 4.70% | 0.43% | 83.23% | T: 0.22% |
| Indica III | 913 | 7.20% | 0.40% | 0.66% | 76.01% | T: 15.66% |
| Indica Intermediate | 786 | 18.20% | 5.50% | 1.15% | 69.21% | T: 5.98% |
| Temperate Japonica | 767 | 98.80% | 0.00% | 0.00% | 1.17% | NA |
| Tropical Japonica | 504 | 65.30% | 0.00% | 0.60% | 34.13% | NA |
| Japonica Intermediate | 241 | 93.40% | 0.00% | 0.00% | 6.64% | NA |
| VI/Aromatic | 96 | 29.20% | 0.00% | 0.00% | 69.79% | T: 1.04% |
| Intermediate | 90 | 47.80% | 3.30% | 1.11% | 42.22% | T: 5.56% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0113601070 | A -> T | LOC_Os01g24120.1 | downstream_gene_variant ; 2484.0bp to feature; MODIFIER | silent_mutation | Average:34.156; most accessible tissue: Callus, score: 91.302 | N | N | N | N |
| vg0113601070 | A -> T | LOC_Os01g24130.1 | downstream_gene_variant ; 486.0bp to feature; MODIFIER | silent_mutation | Average:34.156; most accessible tissue: Callus, score: 91.302 | N | N | N | N |
| vg0113601070 | A -> T | LOC_Os01g24120-LOC_Os01g24130 | intergenic_region ; MODIFIER | silent_mutation | Average:34.156; most accessible tissue: Callus, score: 91.302 | N | N | N | N |
| vg0113601070 | A -> DEL | N | N | silent_mutation | Average:34.156; most accessible tissue: Callus, score: 91.302 | N | N | N | N |
| vg0113601070 | A -> C | LOC_Os01g24120.1 | downstream_gene_variant ; 2484.0bp to feature; MODIFIER | silent_mutation | Average:34.156; most accessible tissue: Callus, score: 91.302 | N | N | N | N |
| vg0113601070 | A -> C | LOC_Os01g24130.1 | downstream_gene_variant ; 486.0bp to feature; MODIFIER | silent_mutation | Average:34.156; most accessible tissue: Callus, score: 91.302 | N | N | N | N |
| vg0113601070 | A -> C | LOC_Os01g24120-LOC_Os01g24130 | intergenic_region ; MODIFIER | silent_mutation | Average:34.156; most accessible tissue: Callus, score: 91.302 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0113601070 | NA | 4.16E-06 | mr1556_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113601070 | NA | 5.70E-06 | mr1738_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113601070 | 4.74E-06 | 4.74E-06 | mr1738_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113601070 | 2.91E-06 | 2.91E-06 | mr1764_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113601070 | 5.81E-06 | 4.53E-06 | mr1811_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113601070 | 3.36E-06 | 1.07E-06 | mr1811_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113601070 | 7.47E-06 | 3.97E-06 | mr1843_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113601070 | 4.20E-06 | 4.21E-06 | mr1847_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |