\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0113601070:

Variant ID: vg0113601070 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 13601070
Reference Allele: AAlternative Allele: T,C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCCACAATCGCGTCCATCATGCGTAGTTGGGGACGCCATCAGTCCATCACTTTTGCGACATCACCTATCATCTACTACAGAATGGGTTTTTGCATACAGA[A/T,C]
GAACATGATCTTCGTATGTGGTCGGCCGGCCCGCATGCGCGAAATGGTCTGCAAAGATCATCATTTGCGTCCAGCCGCATGCGAAGATCGATCTTCGCAT

Reverse complement sequence

ATGCGAAGATCGATCTTCGCATGCGGCTGGACGCAAATGATGATCTTTGCAGACCATTTCGCGCATGCGGGCCGGCCGACCACATACGAAGATCATGTTC[T/A,G]
TCTGTATGCAAAAACCCATTCTGTAGTAGATGATAGGTGATGTCGCAAAAGTGATGGACTGATGGCGTCCCCAACTACGCATGATGGACGCGATTGTGGG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 38.90% 4.80% 0.72% 51.40% T: 4.19%
All Indica  2759 15.80% 8.10% 0.94% 68.25% T: 6.96%
All Japonica  1512 86.80% 0.00% 0.20% 13.03% NA
Aus  269 7.80% 0.00% 1.49% 90.71% NA
Indica I  595 29.10% 25.90% 1.51% 43.36% T: 0.17%
Indica II  465 11.40% 4.70% 0.43% 83.23% T: 0.22%
Indica III  913 7.20% 0.40% 0.66% 76.01% T: 15.66%
Indica Intermediate  786 18.20% 5.50% 1.15% 69.21% T: 5.98%
Temperate Japonica  767 98.80% 0.00% 0.00% 1.17% NA
Tropical Japonica  504 65.30% 0.00% 0.60% 34.13% NA
Japonica Intermediate  241 93.40% 0.00% 0.00% 6.64% NA
VI/Aromatic  96 29.20% 0.00% 0.00% 69.79% T: 1.04%
Intermediate  90 47.80% 3.30% 1.11% 42.22% T: 5.56%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0113601070 A -> T LOC_Os01g24120.1 downstream_gene_variant ; 2484.0bp to feature; MODIFIER silent_mutation Average:34.156; most accessible tissue: Callus, score: 91.302 N N N N
vg0113601070 A -> T LOC_Os01g24130.1 downstream_gene_variant ; 486.0bp to feature; MODIFIER silent_mutation Average:34.156; most accessible tissue: Callus, score: 91.302 N N N N
vg0113601070 A -> T LOC_Os01g24120-LOC_Os01g24130 intergenic_region ; MODIFIER silent_mutation Average:34.156; most accessible tissue: Callus, score: 91.302 N N N N
vg0113601070 A -> DEL N N silent_mutation Average:34.156; most accessible tissue: Callus, score: 91.302 N N N N
vg0113601070 A -> C LOC_Os01g24120.1 downstream_gene_variant ; 2484.0bp to feature; MODIFIER silent_mutation Average:34.156; most accessible tissue: Callus, score: 91.302 N N N N
vg0113601070 A -> C LOC_Os01g24130.1 downstream_gene_variant ; 486.0bp to feature; MODIFIER silent_mutation Average:34.156; most accessible tissue: Callus, score: 91.302 N N N N
vg0113601070 A -> C LOC_Os01g24120-LOC_Os01g24130 intergenic_region ; MODIFIER silent_mutation Average:34.156; most accessible tissue: Callus, score: 91.302 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0113601070 NA 4.16E-06 mr1556_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113601070 NA 5.70E-06 mr1738_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113601070 4.74E-06 4.74E-06 mr1738_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113601070 2.91E-06 2.91E-06 mr1764_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113601070 5.81E-06 4.53E-06 mr1811_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113601070 3.36E-06 1.07E-06 mr1811_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113601070 7.47E-06 3.97E-06 mr1843_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113601070 4.20E-06 4.21E-06 mr1847_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251