Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0113600896:

Variant ID: vg0113600896 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 13600896
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.02, others allele: 0.00, population size: 41. )

Flanking Sequence (100 bp) in Reference Genome:

CACCGTGCCTTCAGGCATCAGGACGTGTCGTGAACAACCCAAACCCCGTCCGGCCAAACATCCTCATGTTGATGCATGGCGCCACAATCTTGTGCATCAC[G/A]
CATAGACGAGGACGCTCTCACTTATGTGATTCTGCCAATTCATCCCGTCGAGGGCGATTCATCAGGCTCCGGCCCCACAATCGCGTCCATCATGCGTAGT

Reverse complement sequence

ACTACGCATGATGGACGCGATTGTGGGGCCGGAGCCTGATGAATCGCCCTCGACGGGATGAATTGGCAGAATCACATAAGTGAGAGCGTCCTCGTCTATG[C/T]
GTGATGCACAAGATTGTGGCGCCATGCATCAACATGAGGATGTTTGGCCGGACGGGGTTTGGGTTGTTCACGACACGTCCTGATGCCTGAAGGCACGGTG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	39.10%	4.80%	1.29%	54.87%	NA
All Indica	2759	16.20%	8.00%	1.96%	73.83%	NA
All Japonica	1512	86.60%	0.00%	0.00%	13.43%	NA
Aus	269	7.80%	0.00%	1.12%	91.08%	NA
Indica I	595	29.90%	26.10%	1.18%	42.86%	NA
Indica II	465	11.00%	4.50%	1.08%	83.44%	NA
Indica III	913	8.00%	0.40%	2.30%	89.27%	NA
Indica Intermediate	786	18.30%	5.30%	2.67%	73.66%	NA
Temperate Japonica	767	98.80%	0.00%	0.00%	1.17%	NA
Tropical Japonica	504	64.90%	0.00%	0.00%	35.12%	NA
Japonica Intermediate	241	92.90%	0.00%	0.00%	7.05%	NA
VI/Aromatic	96	29.20%	0.00%	1.04%	69.79%	NA
Intermediate	90	47.80%	3.30%	3.33%	45.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0113600896	G -> A	LOC_Os01g24120.1	downstream_gene_variant ; 2310.0bp to feature; MODIFIER	silent_mutation	Average:33.659; most accessible tissue: Callus, score: 86.591	N	N	N	N
vg0113600896	G -> A	LOC_Os01g24130.1	downstream_gene_variant ; 660.0bp to feature; MODIFIER	silent_mutation	Average:33.659; most accessible tissue: Callus, score: 86.591	N	N	N	N
vg0113600896	G -> A	LOC_Os01g24120-LOC_Os01g24130	intergenic_region ; MODIFIER	silent_mutation	Average:33.659; most accessible tissue: Callus, score: 86.591	N	N	N	N
vg0113600896	G -> DEL	N	N	silent_mutation	Average:33.659; most accessible tissue: Callus, score: 86.591	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0113600896	NA	3.12E-06	mr1338_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113600896	4.14E-06	4.24E-06	mr1373_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113600896	NA	5.14E-06	mr1747_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113600896	NA	6.25E-06	mr1840_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113600896	NA	5.93E-06	mr1843_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113600896	5.62E-06	5.64E-06	mr1847_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251