Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0113584886:

Variant ID: vg0113584886 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 13584886
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.02, others allele: 0.00, population size: 59. )

Flanking Sequence (100 bp) in Reference Genome:


CCGTGGGGAAGGGGAAGGACGCCGGAGAACGGACTGACATGGAAGTGGATGACATTTTGGAGGGAAGCGAACTCCGTTTACCAAATGCCCAATTGGGATA[G/A]
GAAAAAGAAAAAAGGGAAATACGCTTTTCAAATCATTGTGTACAACGTGTGGTGAGTAATAATCACGATATCTTCAGGAACTCGGCCAGGTCAATCGAAA

Reverse complement sequence

TTTCGATTGACCTGGCCGAGTTCCTGAAGATATCGTGATTATTACTCACCACACGTTGTACACAATGATTTGAAAAGCGTATTTCCCTTTTTTCTTTTTC[C/T]
TATCCCAATTGGGCATTTGGTAAACGGAGTTCGCTTCCCTCCAAAATGTCATCCACTTCCATGTCAGTCCGTTCTCCGGCGTCCTTCCCCTTCCCCACGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.90% 28.80% 5.35% 13.92% NA
All Indica  2759 31.60% 47.30% 3.12% 18.01% NA
All Japonica  1512 92.10% 0.40% 5.09% 2.45% NA
Aus  269 39.40% 7.40% 23.42% 29.74% NA
Indica I  595 50.60% 46.10% 1.18% 2.18% NA
Indica II  465 12.90% 80.20% 1.51% 5.38% NA
Indica III  913 29.60% 34.20% 4.16% 32.09% NA
Indica Intermediate  786 30.50% 44.00% 4.33% 21.12% NA
Temperate Japonica  767 99.00% 0.10% 0.65% 0.26% NA
Tropical Japonica  504 80.40% 0.80% 12.90% 5.95% NA
Japonica Intermediate  241 94.60% 0.40% 2.90% 2.07% NA
VI/Aromatic  96 32.30% 5.20% 19.79% 42.71% NA
Intermediate  90 60.00% 27.80% 8.89% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0113584886 G -> A LOC_Os01g24090.1 5_prime_UTR_variant ; 46.0bp to feature; MODIFIER silent_mutation Average:79.367; most accessible tissue: Zhenshan97 flag leaf, score: 89.49 N N N N
vg0113584886 G -> A LOC_Os01g24090.2 5_prime_UTR_variant ; 46.0bp to feature; MODIFIER silent_mutation Average:79.367; most accessible tissue: Zhenshan97 flag leaf, score: 89.49 N N N N
vg0113584886 G -> A LOC_Os01g24080.1 downstream_gene_variant ; 3677.0bp to feature; MODIFIER silent_mutation Average:79.367; most accessible tissue: Zhenshan97 flag leaf, score: 89.49 N N N N
vg0113584886 G -> DEL N N silent_mutation Average:79.367; most accessible tissue: Zhenshan97 flag leaf, score: 89.49 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0113584886 G A 0.04 0.0 0.01 0.02 0.02 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0113584886 NA 2.54E-07 mr1030 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113584886 NA 8.87E-08 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113584886 NA 1.03E-11 mr1175 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113584886 NA 1.02E-10 mr1316 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113584886 NA 6.38E-10 mr1379 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113584886 NA 9.76E-10 mr1578 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113584886 NA 1.42E-08 mr1637 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113584886 NA 3.47E-08 mr1666 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113584886 NA 1.12E-10 mr1716 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113584886 NA 1.43E-06 mr1749 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113584886 NA 6.29E-08 mr1761 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113584886 NA 1.57E-07 mr1804 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113584886 NA 8.77E-06 mr1821 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113584886 NA 4.75E-06 mr1876 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113584886 NA 6.72E-10 mr1338_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251