\
| Variant ID: vg0113584309 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 13584309 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.53, A: 0.47, others allele: 0.00, population size: 72. )
AAGCCCCCTTTGCCAGAGATCTGAAACAAAGCACAATTGCAGCCAGTTGTACATTGCTGACTCACACTCTGAAATCTGAACTTTGAAGTGTTACAAATAC[A/G]
TACATTTCTTCTGCCGCTGATCGAGCTCAATTGCCCGATCGAACTCTGCTACTGAGCCAGCTACATCTCCCTGTAATGCAAAGATAGGACGAACAGAAAA
TTTTCTGTTCGTCCTATCTTTGCATTACAGGGAGATGTAGCTGGCTCAGTAGCAGAGTTCGATCGGGCAATTGAGCTCGATCAGCGGCAGAAGAAATGTA[T/C]
GTATTTGTAACACTTCAAAGTTCAGATTTCAGAGTGTGAGTCAGCAATGTACAACTGGCTGCAATTGTGCTTTGTTTCAGATCTCTGGCAAAGGGGGCTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 54.50% | 45.30% | 0.21% | 0.00% | NA |
| All Indica | 2759 | 72.30% | 27.40% | 0.29% | 0.00% | NA |
| All Japonica | 1512 | 13.80% | 86.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 96.70% | 2.60% | 0.74% | 0.00% | NA |
| Indica I | 595 | 50.40% | 48.90% | 0.67% | 0.00% | NA |
| Indica II | 465 | 88.20% | 11.40% | 0.43% | 0.00% | NA |
| Indica III | 913 | 76.70% | 23.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 74.30% | 25.40% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 1.30% | 98.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 35.70% | 64.30% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 7.50% | 92.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 71.90% | 28.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 47.80% | 52.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0113584309 | A -> G | LOC_Os01g24090.2 | missense_variant ; p.Met113Thr; MODERATE | nonsynonymous_codon ; M113T | Average:76.143; most accessible tissue: Zhenshan97 flower, score: 85.807 | unknown | unknown | DELETERIOUS | 0.04 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0113584309 | 4.66E-06 | 1.19E-08 | mr1064 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113584309 | NA | 4.12E-06 | mr1073 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113584309 | NA | 4.54E-08 | mr1193 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113584309 | NA | 2.37E-06 | mr1291 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113584309 | NA | 1.89E-10 | mr1471 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113584309 | NA | 2.23E-06 | mr1534 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113584309 | NA | 8.65E-06 | mr1677 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113584309 | NA | 1.63E-10 | mr1722 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113584309 | NA | 9.40E-08 | mr1815 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113584309 | NA | 2.03E-06 | mr1830 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113584309 | NA | 1.08E-08 | mr1519_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |