\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0113583492:

Variant ID: vg0113583492 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 13583492
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.03, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:


GTCAAGAAGAATATTAGAAATTTGTACATGTAGGACGCGTTATGTCGTATGCATAGAAAATTTTAAGAAATTTATAAATGTGGTCATCATCAAGTGAGTA[C/T]
GGACGCCCAATAGCACTGTATTCGTTTAGTACTCTGCCAGCTGATCTCAGCTTAAGACACTTTTAGTCAATTGATAATTTGAATTTGTTATGTACTGCAG

Reverse complement sequence

CTGCAGTACATAACAAATTCAAATTATCAATTGACTAAAAGTGTCTTAAGCTGAGATCAGCTGGCAGAGTACTAAACGAATACAGTGCTATTGGGCGTCC[G/A]
TACTCACTTGATGATGACCACATTTATAAATTTCTTAAAATTTTCTATGCATACGACATAACGCGTCCTACATGTACAAATTTCTAATATTCTTCTTGAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.00% 4.90% 0.57% 0.53% NA
All Indica  2759 92.40% 6.90% 0.58% 0.18% NA
All Japonica  1512 96.10% 2.70% 0.46% 0.73% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 83.20% 16.80% 0.00% 0.00% NA
Indica II  465 98.30% 0.90% 0.43% 0.43% NA
Indica III  913 98.10% 0.40% 1.10% 0.33% NA
Indica Intermediate  786 89.20% 10.30% 0.51% 0.00% NA
Temperate Japonica  767 98.20% 1.70% 0.13% 0.00% NA
Tropical Japonica  504 91.90% 5.00% 1.19% 1.98% NA
Japonica Intermediate  241 98.30% 1.20% 0.00% 0.41% NA
VI/Aromatic  96 88.50% 0.00% 3.12% 8.33% NA
Intermediate  90 96.70% 1.10% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0113583492 C -> T LOC_Os01g24080.1 downstream_gene_variant ; 2283.0bp to feature; MODIFIER silent_mutation Average:47.999; most accessible tissue: Minghui63 flag leaf, score: 67.099 N N N N
vg0113583492 C -> T LOC_Os01g24090.1 intron_variant ; MODIFIER silent_mutation Average:47.999; most accessible tissue: Minghui63 flag leaf, score: 67.099 N N N N
vg0113583492 C -> T LOC_Os01g24090.2 intron_variant ; MODIFIER silent_mutation Average:47.999; most accessible tissue: Minghui63 flag leaf, score: 67.099 N N N N
vg0113583492 C -> DEL N N silent_mutation Average:47.999; most accessible tissue: Minghui63 flag leaf, score: 67.099 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0113583492 NA 2.44E-06 mr1064 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113583492 NA 4.44E-06 mr1136 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113583492 NA 3.26E-07 mr1316 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113583492 NA 7.21E-07 mr1716 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113583492 NA 4.20E-07 mr1741 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251