Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0113561451:

Variant ID: vg0113561451 (JBrowse)Variation Type: INDEL
Chromosome: chr01Position: 13561451
Reference Allele: CAlternative Allele: CT,T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.71, C: 0.29, others allele: 0.00, population size: 73. )

Flanking Sequence (100 bp) in Reference Genome:


ACGCAGTTCAGGAAGCTGCTCTCTGTCGGTGCGTGTTGCTATTTGCCCCCCCCCCCACCCCCCACCCCACCAAAATCCCCGCCCCAATTTGAATTGCTCC[C/CT,T]
TTTTGTTTTGACGAAATTGTAGCGAAACTATCATGCTTTTGTAAAATCGTACTGCAATCGATCATCGTGGCTCATGGAATTTTTGTTCAATGTTCATGCT

Reverse complement sequence

AGCATGAACATTGAACAAAAATTCCATGAGCCACGATGATCGATTGCAGTACGATTTTACAAAAGCATGATAGTTTCGCTACAATTTCGTCAAAACAAAA[G/AG,A]
GGAGCAATTCAAATTGGGGCGGGGATTTTGGTGGGGTGGGGGGTGGGGGGGGGGGCAAATAGCAACACGCACCGACAGAGAGCAGCTTCCTGAACTGCGT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.80% 41.40% 0.11% 0.00% CT: 9.75%
All Indica  2759 71.80% 13.80% 0.11% 0.00% CT: 14.28%
All Japonica  1512 16.70% 83.20% 0.00% 0.00% CT: 0.07%
Aus  269 2.20% 91.40% 0.00% 0.00% CT: 6.32%
Indica I  595 92.80% 5.20% 0.17% 0.00% CT: 1.85%
Indica II  465 80.60% 15.30% 0.22% 0.00% CT: 3.87%
Indica III  913 56.50% 16.90% 0.11% 0.00% CT: 26.51%
Indica Intermediate  786 68.60% 15.80% 0.00% 0.00% CT: 15.65%
Temperate Japonica  767 3.00% 97.00% 0.00% 0.00% NA
Tropical Japonica  504 41.70% 58.30% 0.00% 0.00% NA
Japonica Intermediate  241 8.30% 91.30% 0.00% 0.00% CT: 0.41%
VI/Aromatic  96 25.00% 27.10% 0.00% 0.00% CT: 47.92%
Intermediate  90 44.40% 50.00% 2.22% 0.00% CT: 3.33%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0113561451 C -> T LOC_Os01g24050.1 downstream_gene_variant ; 4467.0bp to feature; MODIFIER silent_mutation Average:80.803; most accessible tissue: Minghui63 flag leaf, score: 89.425 N N N N
vg0113561451 C -> T LOC_Os01g24060.1 intron_variant ; MODIFIER silent_mutation Average:80.803; most accessible tissue: Minghui63 flag leaf, score: 89.425 N N N N
vg0113561451 C -> T LOC_Os01g24060.2 intron_variant ; MODIFIER silent_mutation Average:80.803; most accessible tissue: Minghui63 flag leaf, score: 89.425 N N N N
vg0113561451 C -> CT LOC_Os01g24050.1 downstream_gene_variant ; 4468.0bp to feature; MODIFIER silent_mutation Average:80.803; most accessible tissue: Minghui63 flag leaf, score: 89.425 N N N N
vg0113561451 C -> CT LOC_Os01g24060.1 intron_variant ; MODIFIER silent_mutation Average:80.803; most accessible tissue: Minghui63 flag leaf, score: 89.425 N N N N
vg0113561451 C -> CT LOC_Os01g24060.2 intron_variant ; MODIFIER silent_mutation Average:80.803; most accessible tissue: Minghui63 flag leaf, score: 89.425 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0113561451 C CT 0.03 0.02 0.01 0.03 0.02 0.02
vg0113561451 C T -0.01 0.0 0.0 -0.01 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0113561451 NA 3.50E-06 mr1073 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113561451 NA 6.55E-10 mr1352 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113561451 NA 6.16E-20 mr1422 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113561451 NA 1.37E-15 mr1583 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113561451 NA 4.61E-07 mr1850 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113561451 NA 2.25E-06 mr1170_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113561451 NA 4.51E-24 mr1422_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113561451 NA 1.63E-06 mr1567_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113561451 NA 4.49E-15 mr1583_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113561451 NA 3.76E-06 mr1691_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113561451 NA 5.47E-09 mr1711_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113561451 NA 8.49E-06 mr1815_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113561451 NA 5.71E-13 mr1850_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113561451 NA 5.78E-06 mr1873_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113561451 NA 1.51E-06 mr1968_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251