\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0113550938:

Variant ID: vg0113550938 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 13550938
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.88, T: 0.12, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


AATTTAGAAAATTTGCTAAAGTAGTGGTAGAGAGGTTATTATAACCACCACCACTTGTTGTATTTTATAGTAGTATATATAGATAGGACTATCACCGGCA[T/C]
AGAAAGGCCAATCTCTACCGTTTCAAAAACTGGCATCTAGACCACCAGTGTTACTCATTTTGGGGACAAAGTAAAATAGATGGTTACATCAACATGTTAC

Reverse complement sequence

GTAACATGTTGATGTAACCATCTATTTTACTTTGTCCCCAAAATGAGTAACACTGGTGGTCTAGATGCCAGTTTTTGAAACGGTAGAGATTGGCCTTTCT[A/G]
TGCCGGTGATAGTCCTATCTATATATACTACTATAAAATACAACAAGTGGTGGTGGTTATAATAACCTCTCTACCACTACTTTAGCAAATTTTCTAAATT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.40% 40.00% 0.25% 9.31% NA
All Indica  2759 34.40% 51.60% 0.40% 13.59% NA
All Japonica  1512 88.20% 11.70% 0.00% 0.07% NA
Aus  269 1.90% 91.80% 0.00% 6.32% NA
Indica I  595 60.70% 37.50% 0.00% 1.85% NA
Indica II  465 11.20% 84.90% 0.22% 3.66% NA
Indica III  913 28.50% 45.90% 0.44% 25.19% NA
Indica Intermediate  786 35.00% 49.40% 0.76% 14.89% NA
Temperate Japonica  767 98.80% 1.20% 0.00% 0.00% NA
Tropical Japonica  504 69.40% 30.60% 0.00% 0.00% NA
Japonica Intermediate  241 93.80% 5.80% 0.00% 0.41% NA
VI/Aromatic  96 52.10% 1.00% 0.00% 46.88% NA
Intermediate  90 52.20% 44.40% 1.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0113550938 T -> DEL N N silent_mutation Average:59.109; most accessible tissue: Callus, score: 96.406 N N N N
vg0113550938 T -> C LOC_Os01g24040.1 downstream_gene_variant ; 2159.0bp to feature; MODIFIER silent_mutation Average:59.109; most accessible tissue: Callus, score: 96.406 N N N N
vg0113550938 T -> C LOC_Os01g24050.1 intron_variant ; MODIFIER silent_mutation Average:59.109; most accessible tissue: Callus, score: 96.406 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0113550938 T C 0.03 0.01 0.02 0.02 0.03 0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0113550938 NA 3.42E-07 mr1064 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113550938 NA 4.80E-06 mr1073 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113550938 NA 3.29E-09 mr1090 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113550938 NA 5.04E-11 mr1188 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113550938 NA 6.22E-10 mr1193 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113550938 NA 2.57E-06 mr1193 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113550938 NA 5.55E-06 mr1236 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113550938 NA 9.53E-06 mr1298 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113550938 NA 7.23E-06 mr1316 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113550938 NA 9.92E-07 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113550938 NA 4.50E-11 mr1471 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113550938 NA 1.23E-07 mr1534 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113550938 NA 8.52E-06 mr1606 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113550938 NA 2.58E-09 mr1629 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113550938 NA 7.19E-07 mr1654 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113550938 NA 7.76E-06 mr1671 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113550938 NA 1.97E-07 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113550938 NA 7.03E-06 mr1968 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113550938 NA 5.17E-07 mr1974 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113550938 NA 3.43E-07 mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113550938 NA 1.29E-06 mr1519_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251