\
| Variant ID: vg0113515835 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 13515835 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.01, others allele: 0.00, population size: 232. )
TATCTAATTCGAAAGCATTTATCTTCTACTTTCACGAACTCTAATGTAATTGCTTGAAACATAAAGTTATTTTAGGATGACAAGCCAGATGCTTAAAAAT[A/G]
AAGTTATTTTGAGACGGAGAGAGTAGGAATCACCGAATCAATATGGCTCAGATCGGACTGCAGGCGACCGAGGTACGCTATGTGGTTCGTTGCGCGAAGT
ACTTCGCGCAACGAACCACATAGCGTACCTCGGTCGCCTGCAGTCCGATCTGAGCCATATTGATTCGGTGATTCCTACTCTCTCCGTCTCAAAATAACTT[T/C]
ATTTTTAAGCATCTGGCTTGTCATCCTAAAATAACTTTATGTTTCAAGCAATTACATTAGAGTTCGTGAAAGTAGAAGATAAATGCTTTCGAATTAGATA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.80% | 35.10% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 89.90% | 10.10% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 14.70% | 85.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 98.50% | 0.70% | 0.74% | 0.00% | NA |
| Indica I | 595 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Indica II | 465 | 96.80% | 3.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 78.50% | 21.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 91.90% | 8.00% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 3.00% | 97.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 36.10% | 63.90% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 7.50% | 92.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 49.00% | 51.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 54.40% | 45.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0113515835 | A -> G | LOC_Os01g24010.1 | upstream_gene_variant ; 1683.0bp to feature; MODIFIER | silent_mutation | Average:56.223; most accessible tissue: Minghui63 panicle, score: 80.641 | N | N | N | N |
| vg0113515835 | A -> G | LOC_Os01g23990-LOC_Os01g24010 | intergenic_region ; MODIFIER | silent_mutation | Average:56.223; most accessible tissue: Minghui63 panicle, score: 80.641 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0113515835 | NA | 1.46E-14 | mr1218 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113515835 | NA | 5.45E-06 | mr1364 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113515835 | NA | 2.77E-10 | mr1471 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113515835 | NA | 1.82E-06 | mr1543 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113515835 | NA | 5.10E-06 | mr1642 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113515835 | NA | 1.13E-06 | mr1646 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113515835 | NA | 1.26E-16 | mr1653 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113515835 | NA | 3.87E-07 | mr1815 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113515835 | NA | 7.06E-07 | mr1871 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113515835 | NA | 1.21E-30 | mr1653_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113515835 | NA | 3.62E-14 | mr1790_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113515835 | NA | 8.33E-07 | mr1815_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |