\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0113510414:

Variant ID: vg0113510414 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 13510414
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.00, others allele: 0.00, population size: 331. )

Flanking Sequence (100 bp) in Reference Genome:


CCCACTTGGTGATAGACTCCCCAACTTATATCTTTGGACTTTTTCCAATTCCACAACCAATTACTGTGGGACTATTTAACATTAACCATGCAATTTTTTC[G/A]
AGATTCATGCTTAATTTGAGCTCCGATACACTGCTAGTGGTGGCACCAAATTGTGATAAGGCTAGTATAGCTAGGACTTGAGCCTTAGGCTAAATGCATG

Reverse complement sequence

CATGCATTTAGCCTAAGGCTCAAGTCCTAGCTATACTAGCCTTATCACAATTTGGTGCCACCACTAGCAGTGTATCGGAGCTCAAATTAAGCATGAATCT[C/T]
GAAAAAATTGCATGGTTAATGTTAAATAGTCCCACAGTAATTGGTTGTGGAATTGGAAAAAGTCCAAAGATATAAGTTGGGGAGTCTATCACCAAGTGGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.80% 6.00% 0.23% 0.00% NA
All Indica  2759 98.90% 1.10% 0.07% 0.00% NA
All Japonica  1512 84.60% 14.90% 0.53% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 98.90% 0.90% 0.22% 0.00% NA
Indica III  913 97.30% 2.60% 0.11% 0.00% NA
Indica Intermediate  786 99.90% 0.10% 0.00% 0.00% NA
Temperate Japonica  767 99.10% 0.90% 0.00% 0.00% NA
Tropical Japonica  504 70.80% 28.60% 0.60% 0.00% NA
Japonica Intermediate  241 67.20% 30.70% 2.07% 0.00% NA
VI/Aromatic  96 81.20% 17.70% 1.04% 0.00% NA
Intermediate  90 88.90% 11.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0113510414 G -> A LOC_Os01g23990.1 upstream_gene_variant ; 1532.0bp to feature; MODIFIER silent_mutation Average:43.84; most accessible tissue: Zhenshan97 young leaf, score: 64.747 N N N N
vg0113510414 G -> A LOC_Os01g23990-LOC_Os01g24010 intergenic_region ; MODIFIER silent_mutation Average:43.84; most accessible tissue: Zhenshan97 young leaf, score: 64.747 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0113510414 NA 8.88E-06 mr1227 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113510414 7.81E-06 7.81E-06 mr1159_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113510414 NA 1.85E-06 mr1267_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113510414 8.28E-06 8.28E-06 mr1312_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113510414 4.57E-06 4.57E-06 mr1374_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113510414 3.66E-06 3.66E-06 mr1524_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113510414 9.30E-08 9.30E-08 mr1663_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113510414 NA 1.76E-06 mr1665_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113510414 NA 6.13E-06 mr1683_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113510414 8.95E-06 8.95E-06 mr1687_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113510414 4.16E-06 4.16E-06 mr1688_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113510414 NA 4.97E-06 mr1738_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113510414 NA 5.06E-07 mr1812_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113510414 1.21E-06 1.21E-06 mr1832_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113510414 NA 3.10E-07 mr1833_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113510414 1.30E-06 1.30E-06 mr1843_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113510414 1.26E-06 1.26E-06 mr1847_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251