\
| Variant ID: vg0113500333 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 13500333 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.07, others allele: 0.00, population size: 99. )
AAGGAAAAGAAATTTCAATGGACTGCAGCCTGTGAAGACAGCTTTCAAGAAATGAAGAAAAGGTTGACCACTGCCCCAGTTCTCACCTTGCCAGATATCC[A/G]
AAAAGATTTCGAAATCTTCTGTGATGCATCAAGACAAGGCTTAGGATGTGTCCTAATGCAAGAACGAAAGGTTGTGGCCTACGCATCCAGGCAGCTCAGG
CCTGAGCTGCCTGGATGCGTAGGCCACAACCTTTCGTTCTTGCATTAGGACACATCCTAAGCCTTGTCTTGATGCATCACAGAAGATTTCGAAATCTTTT[T/C]
GGATATCTGGCAAGGTGAGAACTGGGGCAGTGGTCAACCTTTTCTTCATTTCTTGAAAGCTGTCTTCACAGGCTGCAGTCCATTGAAATTTCTTTTCCTT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 33.60% | 4.40% | 9.31% | 52.73% | NA |
| All Indica | 2759 | 8.90% | 0.80% | 11.67% | 78.62% | NA |
| All Japonica | 1512 | 83.10% | 11.60% | 2.98% | 2.38% | NA |
| Aus | 269 | 2.60% | 1.50% | 20.45% | 75.46% | NA |
| Indica I | 595 | 8.10% | 0.00% | 5.88% | 86.05% | NA |
| Indica II | 465 | 9.00% | 0.60% | 5.16% | 85.16% | NA |
| Indica III | 913 | 8.90% | 0.30% | 17.74% | 73.06% | NA |
| Indica Intermediate | 786 | 9.50% | 2.00% | 12.85% | 75.57% | NA |
| Temperate Japonica | 767 | 97.10% | 1.20% | 0.13% | 1.56% | NA |
| Tropical Japonica | 504 | 57.50% | 30.40% | 8.33% | 3.77% | NA |
| Japonica Intermediate | 241 | 91.70% | 5.40% | 0.83% | 2.07% | NA |
| VI/Aromatic | 96 | 36.50% | 0.00% | 9.38% | 54.17% | NA |
| Intermediate | 90 | 48.90% | 5.60% | 10.00% | 35.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0113500333 | A -> G | LOC_Os01g23980.1 | missense_variant ; p.Gln912Arg; MODERATE | nonsynonymous_codon ; Q912R | Average:10.05; most accessible tissue: Minghui63 root, score: 17.665 | benign |
-0.26 |
TOLERATED | 1.00 |
| vg0113500333 | A -> DEL | LOC_Os01g23980.1 | N | frameshift_variant | Average:10.05; most accessible tissue: Minghui63 root, score: 17.665 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0113500333 | NA | 8.32E-06 | mr1047 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113500333 | NA | 8.28E-06 | mr1188 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113500333 | NA | 8.49E-07 | mr1471 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113500333 | NA | 8.07E-07 | mr1543 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113500333 | NA | 1.12E-06 | mr1642 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113500333 | NA | 1.68E-07 | mr1047_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113500333 | NA | 5.64E-08 | mr1653_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113500333 | NA | 1.33E-06 | mr1782_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113500333 | 8.45E-07 | 5.71E-09 | mr1815_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |