Variant ID: vg0113491943 (JBrowse) | Variation Type: SNP |
Chromosome: chr01 | Position: 13491943 |
Reference Allele: C | Alternative Allele: G |
Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, A: 0.04, others allele: 0.00, population size: 113. )
ATATATATATATAGACACACTCAAGAAGTGATATTTAGTATTACAAAATGCATGTGGAATACTAGGTAGAATTGACTAGTGTAAGGAATCTTCACCCCTC[C/G]
TATTCTATAATCATGACAAATCCTTATCACTTGTCAAGATCTATGTGGACTTATTCAAACAAGTGATATACTCAGGTTAAATGACTAATTTTACCATTCT
AGAATGGTAAAATTAGTCATTTAACCTGAGTATATCACTTGTTTGAATAAGTCCACATAGATCTTGACAAGTGATAAGGATTTGTCATGATTATAGAATA[G/C]
GAGGGGTGAAGATTCCTTACACTAGTCAATTCTACCTAGTATTCCACATGCATTTTGTAATACTAAATATCACTTCTTGAGTGTGTCTATATATATATAT
Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 86.60% | 13.00% | 0.25% | 0.08% | NA |
All Indica | 2759 | 80.10% | 19.50% | 0.33% | 0.14% | NA |
All Japonica | 1512 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
Aus | 269 | 90.70% | 8.20% | 1.12% | 0.00% | NA |
Indica I | 595 | 91.40% | 8.40% | 0.17% | 0.00% | NA |
Indica II | 465 | 95.10% | 4.30% | 0.43% | 0.22% | NA |
Indica III | 913 | 69.10% | 30.20% | 0.44% | 0.22% | NA |
Indica Intermediate | 786 | 75.30% | 24.30% | 0.25% | 0.13% | NA |
Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 54.20% | 45.80% | 0.00% | 0.00% | NA |
Intermediate | 90 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0113491943 | C -> G | LOC_Os01g23980.1 | upstream_gene_variant ; 4335.0bp to feature; MODIFIER | silent_mutation | Average:33.858; most accessible tissue: Zhenshan97 young leaf, score: 45.96 | N | N | N | N |
vg0113491943 | C -> G | LOC_Os01g23970.1 | downstream_gene_variant ; 1652.0bp to feature; MODIFIER | silent_mutation | Average:33.858; most accessible tissue: Zhenshan97 young leaf, score: 45.96 | N | N | N | N |
vg0113491943 | C -> G | LOC_Os01g23970-LOC_Os01g23980 | intergenic_region ; MODIFIER | silent_mutation | Average:33.858; most accessible tissue: Zhenshan97 young leaf, score: 45.96 | N | N | N | N |
vg0113491943 | C -> DEL | N | N | silent_mutation | Average:33.858; most accessible tissue: Zhenshan97 young leaf, score: 45.96 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0113491943 | NA | 8.91E-06 | mr1049 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0113491943 | 9.96E-06 | 9.52E-10 | mr1125 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0113491943 | NA | 8.25E-06 | mr1166 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0113491943 | NA | 6.11E-08 | mr1193 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0113491943 | 2.65E-08 | 2.65E-08 | mr1398 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0113491943 | NA | 1.00E-11 | mr1458 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0113491943 | NA | 5.53E-06 | mr1981 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0113491943 | NA | 8.43E-06 | mr1027_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0113491943 | NA | 1.30E-11 | mr1458_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0113491943 | NA | 4.40E-06 | mr1533_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |