Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0113491943:

Variant ID: vg0113491943 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 13491943
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, A: 0.04, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


ATATATATATATAGACACACTCAAGAAGTGATATTTAGTATTACAAAATGCATGTGGAATACTAGGTAGAATTGACTAGTGTAAGGAATCTTCACCCCTC[C/G]
TATTCTATAATCATGACAAATCCTTATCACTTGTCAAGATCTATGTGGACTTATTCAAACAAGTGATATACTCAGGTTAAATGACTAATTTTACCATTCT

Reverse complement sequence

AGAATGGTAAAATTAGTCATTTAACCTGAGTATATCACTTGTTTGAATAAGTCCACATAGATCTTGACAAGTGATAAGGATTTGTCATGATTATAGAATA[G/C]
GAGGGGTGAAGATTCCTTACACTAGTCAATTCTACCTAGTATTCCACATGCATTTTGTAATACTAAATATCACTTCTTGAGTGTGTCTATATATATATAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.60% 13.00% 0.25% 0.08% NA
All Indica  2759 80.10% 19.50% 0.33% 0.14% NA
All Japonica  1512 99.50% 0.50% 0.00% 0.00% NA
Aus  269 90.70% 8.20% 1.12% 0.00% NA
Indica I  595 91.40% 8.40% 0.17% 0.00% NA
Indica II  465 95.10% 4.30% 0.43% 0.22% NA
Indica III  913 69.10% 30.20% 0.44% 0.22% NA
Indica Intermediate  786 75.30% 24.30% 0.25% 0.13% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.00% 1.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 54.20% 45.80% 0.00% 0.00% NA
Intermediate  90 94.40% 5.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0113491943 C -> G LOC_Os01g23980.1 upstream_gene_variant ; 4335.0bp to feature; MODIFIER silent_mutation Average:33.858; most accessible tissue: Zhenshan97 young leaf, score: 45.96 N N N N
vg0113491943 C -> G LOC_Os01g23970.1 downstream_gene_variant ; 1652.0bp to feature; MODIFIER silent_mutation Average:33.858; most accessible tissue: Zhenshan97 young leaf, score: 45.96 N N N N
vg0113491943 C -> G LOC_Os01g23970-LOC_Os01g23980 intergenic_region ; MODIFIER silent_mutation Average:33.858; most accessible tissue: Zhenshan97 young leaf, score: 45.96 N N N N
vg0113491943 C -> DEL N N silent_mutation Average:33.858; most accessible tissue: Zhenshan97 young leaf, score: 45.96 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0113491943 NA 8.91E-06 mr1049 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113491943 9.96E-06 9.52E-10 mr1125 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113491943 NA 8.25E-06 mr1166 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113491943 NA 6.11E-08 mr1193 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113491943 2.65E-08 2.65E-08 mr1398 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113491943 NA 1.00E-11 mr1458 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113491943 NA 5.53E-06 mr1981 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113491943 NA 8.43E-06 mr1027_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113491943 NA 1.30E-11 mr1458_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113491943 NA 4.40E-06 mr1533_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251