\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0113491737:

Variant ID: vg0113491737 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 13491737
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 119. )

Flanking Sequence (100 bp) in Reference Genome:


TTTTTAATTCCGAATTTCAACTATTTCTAAATTGTATTTCTATATGGACTCTGTTTTTCTTTTTCTCCGATTAATATGAGAATTTCTAAGCCATGAGAGC[G/A]
AACGTGGAGGCTCCTTTTTCTATTTCTTTAATAAGTTAATAGATTACACTAAGGTCGATCTTAAATCATCTCATAGAGTATATATATATATATATATATA

Reverse complement sequence

TATATATATATATATATATATACTCTATGAGATGATTTAAGATCGACCTTAGTGTAATCTATTAACTTATTAAAGAAATAGAAAAAGGAGCCTCCACGTT[C/T]
GCTCTCATGGCTTAGAAATTCTCATATTAATCGGAGAAAAAGAAAAACAGAGTCCATATAGAAATACAATTTAGAAATAGTTGAAATTCGGAATTAAAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.00% 12.90% 0.11% 0.00% NA
All Indica  2759 80.50% 19.40% 0.11% 0.00% NA
All Japonica  1512 99.50% 0.50% 0.00% 0.00% NA
Aus  269 91.40% 7.80% 0.74% 0.00% NA
Indica I  595 91.60% 8.40% 0.00% 0.00% NA
Indica II  465 95.70% 4.30% 0.00% 0.00% NA
Indica III  913 70.00% 29.80% 0.22% 0.00% NA
Indica Intermediate  786 75.40% 24.40% 0.13% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 98.80% 1.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 56.20% 43.80% 0.00% 0.00% NA
Intermediate  90 95.60% 4.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0113491737 G -> A LOC_Os01g23980.1 upstream_gene_variant ; 4541.0bp to feature; MODIFIER silent_mutation Average:27.265; most accessible tissue: Callus, score: 42.747 N N N N
vg0113491737 G -> A LOC_Os01g23970.1 downstream_gene_variant ; 1446.0bp to feature; MODIFIER silent_mutation Average:27.265; most accessible tissue: Callus, score: 42.747 N N N N
vg0113491737 G -> A LOC_Os01g23970-LOC_Os01g23980 intergenic_region ; MODIFIER silent_mutation Average:27.265; most accessible tissue: Callus, score: 42.747 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0113491737 NA 5.34E-07 mr1049 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113491737 NA 8.10E-06 mr1122 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113491737 NA 2.34E-08 mr1125 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113491737 NA 3.92E-06 mr1166 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113491737 NA 3.99E-07 mr1193 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113491737 1.82E-08 1.82E-08 mr1398 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113491737 NA 5.15E-11 mr1458 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113491737 NA 5.22E-06 mr1516 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113491737 NA 5.71E-06 mr1543 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113491737 NA 4.01E-06 mr1888 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113491737 NA 3.17E-06 mr1981 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113491737 NA 7.20E-10 mr1458_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113491737 NA 4.38E-06 mr1533_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251