\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0113475773:

Variant ID: vg0113475773 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 13475773
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGAGTTATTTTATCACTAAAAATATTTTAAGTATCATTTATATCATATATATTAGTATAAATTTTTTAATAATACGAATGATCAAAAGTATATCAAAAAT[C/T]
AACAGCGTCACTATTAAAATAAAGAGAGGGATTATATATATTTATATATATTTGCCCTCATCCACGTCGTGTAGGACATTCATCCTAGAGTAGTCGAGTG

Reverse complement sequence

CACTCGACTACTCTAGGATGAATGTCCTACACGACGTGGATGAGGGCAAATATATATAAATATATATAATCCCTCTCTTTATTTTAATAGTGACGCTGTT[G/A]
ATTTTTGATATACTTTTGATCATTCGTATTATTAAAAAATTTATACTAATATATATGATATAAATGATACTTAAAATATTTTTAGTGATAAAATAACTCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.80% 3.90% 6.41% 27.87% NA
All Indica  2759 53.90% 0.40% 8.59% 37.15% NA
All Japonica  1512 84.90% 11.20% 0.53% 3.31% NA
Aus  269 10.80% 0.00% 18.59% 70.63% NA
Indica I  595 38.50% 0.00% 12.94% 48.57% NA
Indica II  465 86.00% 0.60% 4.30% 9.03% NA
Indica III  913 52.90% 0.10% 7.34% 39.65% NA
Indica Intermediate  786 47.70% 0.80% 9.29% 42.24% NA
Temperate Japonica  767 96.20% 1.20% 0.13% 2.48% NA
Tropical Japonica  504 63.70% 29.40% 1.39% 5.56% NA
Japonica Intermediate  241 93.40% 5.40% 0.00% 1.24% NA
VI/Aromatic  96 53.10% 0.00% 7.29% 39.58% NA
Intermediate  90 77.80% 5.60% 1.11% 15.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0113475773 C -> T LOC_Os01g23960.1 downstream_gene_variant ; 42.0bp to feature; MODIFIER silent_mutation Average:63.287; most accessible tissue: Zhenshan97 root, score: 92.725 N N N N
vg0113475773 C -> T LOC_Os01g23940-LOC_Os01g23960 intergenic_region ; MODIFIER silent_mutation Average:63.287; most accessible tissue: Zhenshan97 root, score: 92.725 N N N N
vg0113475773 C -> DEL N N silent_mutation Average:63.287; most accessible tissue: Zhenshan97 root, score: 92.725 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0113475773 C T -0.01 0.0 0.0 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0113475773 4.36E-07 1.34E-07 mr1188 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113475773 NA 1.38E-06 mr1543 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113475773 NA 6.60E-07 mr1815_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251