Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0113441758:

Variant ID: vg0113441758 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 13441758
Reference Allele: T	Alternative Allele: G
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.90, T: 0.10, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:

ACCCGAGCCCGAGTCAGCGCCACTATCCTCCAACCCGGCCTACACTCGAACGTCATCCAAAGCTTGAGGCATGCCCGCCAGCTGCATCTCCTCTAGAGGC[T/G]
CTTCCTTCACTCAGCCTCTCCAACGACGATGACGACACCGGCCAACATTGGAGGATATGCGATTTTTGTGTGCCTAATTTGTTTTGATCTAAAATTTATA

Reverse complement sequence

TATAAATTTTAGATCAAAACAAATTAGGCACACAAAAATCGCATATCCTCCAATGTTGGCCGGTGTCGTCATCGTCGTTGGAGAGGCTGAGTGAAGGAAG[A/C]
GCCTCTAGAGGAGATGCAGCTGGCGGGCATGCCTCAAGCTTTGGATGACGTTCGAGTGTAGGCCGGGTTGGAGGATAGTGGCGCTGACTCGGGCTCGGGT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	71.00%	29.00%	0.04%	0.00%	NA
All Indica	2759	97.60%	2.30%	0.04%	0.00%	NA
All Japonica	1512	17.10%	82.90%	0.07%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	97.10%	2.70%	0.17%	0.00%	NA
Indica II	465	98.30%	1.70%	0.00%	0.00%	NA
Indica III	913	97.20%	2.80%	0.00%	0.00%	NA
Indica Intermediate	786	98.20%	1.80%	0.00%	0.00%	NA
Temperate Japonica	767	3.00%	97.00%	0.00%	0.00%	NA
Tropical Japonica	504	42.30%	57.50%	0.20%	0.00%	NA
Japonica Intermediate	241	9.10%	90.90%	0.00%	0.00%	NA
VI/Aromatic	96	82.30%	17.70%	0.00%	0.00%	NA
Intermediate	90	61.10%	38.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0113441758	T -> G	LOC_Os01g23870.1	upstream_gene_variant ; 3172.0bp to feature; MODIFIER	silent_mutation	Average:59.671; most accessible tissue: Callus, score: 82.979	N	N	N	N
vg0113441758	T -> G	LOC_Os01g23880.1	upstream_gene_variant ; 738.0bp to feature; MODIFIER	silent_mutation	Average:59.671; most accessible tissue: Callus, score: 82.979	N	N	N	N
vg0113441758	T -> G	LOC_Os01g23890.1	downstream_gene_variant ; 2258.0bp to feature; MODIFIER	silent_mutation	Average:59.671; most accessible tissue: Callus, score: 82.979	N	N	N	N
vg0113441758	T -> G	LOC_Os01g23870-LOC_Os01g23880	intergenic_region ; MODIFIER	silent_mutation	Average:59.671; most accessible tissue: Callus, score: 82.979	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0113441758	NA	4.64E-59	Grain_width	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0113441758	NA	3.47E-20	mr1102	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113441758	NA	1.45E-43	mr1136	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113441758	NA	1.30E-10	mr1188	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113441758	NA	1.11E-35	mr1448	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113441758	NA	7.94E-11	mr1471	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113441758	NA	2.97E-15	mr1653	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113441758	NA	7.71E-60	mr1711	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113441758	NA	3.69E-09	mr1722	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113441758	NA	5.98E-73	mr1778	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113441758	NA	4.01E-07	mr1815	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113441758	NA	1.82E-15	mr1830	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113441758	NA	5.92E-06	mr1990	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113441758	NA	2.74E-07	mr1030_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113441758	NA	5.29E-62	mr1125_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113441758	NA	3.45E-54	mr1136_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113441758	NA	1.80E-52	mr1261_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113441758	NA	1.52E-34	mr1448_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113441758	NA	5.29E-28	mr1653_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113441758	NA	5.78E-19	mr1682_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113441758	NA	3.04E-17	mr1712_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113441758	NA	2.78E-07	mr1749_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113441758	NA	1.39E-73	mr1778_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113441758	NA	5.97E-06	mr1815_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113441758	NA	3.09E-15	mr1866_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251