\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0113419706:

Variant ID: vg0113419706 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 13419706
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGTTTTGTAAGTAGTCTATATTTAATACTCTAAATTAGTGTCTAAAGACAGGGACTAAAGTTAAGTCCCTGGATCTAAACACCACCTAAAACTTTTAAGT[C/A]
CCTATCACATCGGATGTTTGAAAATTAATTATAAATATTAAACGTAGACTATTAATAAAACTCATCCATAATCTTGGACTAATTTGCGAGACGAATCTAA

Reverse complement sequence

TTAGATTCGTCTCGCAAATTAGTCCAAGATTATGGATGAGTTTTATTAATAGTCTACGTTTAATATTTATAATTAATTTTCAAACATCCGATGTGATAGG[G/T]
ACTTAAAAGTTTTAGGTGGTGTTTAGATCCAGGGACTTAACTTTAGTCCCTGTCTTTAGACACTAATTTAGAGTATTAAATATAGACTACTTACAAAACT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.30% 0.20% 26.15% 11.40% NA
All Indica  2759 42.00% 0.00% 40.20% 17.80% NA
All Japonica  1512 96.80% 0.00% 2.71% 0.46% NA
Aus  269 71.00% 3.00% 14.87% 11.15% NA
Indica I  595 32.40% 0.00% 32.94% 34.62% NA
Indica II  465 46.00% 0.00% 48.17% 5.81% NA
Indica III  913 45.60% 0.00% 43.70% 10.73% NA
Indica Intermediate  786 42.70% 0.00% 36.90% 20.36% NA
Temperate Japonica  767 98.30% 0.00% 1.17% 0.52% NA
Tropical Japonica  504 94.40% 0.00% 5.16% 0.40% NA
Japonica Intermediate  241 97.10% 0.00% 2.49% 0.41% NA
VI/Aromatic  96 65.60% 0.00% 28.12% 6.25% NA
Intermediate  90 73.30% 0.00% 21.11% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0113419706 C -> A LOC_Os01g23840.1 upstream_gene_variant ; 4474.0bp to feature; MODIFIER silent_mutation Average:9.249; most accessible tissue: Callus, score: 34.686 N N N N
vg0113419706 C -> A LOC_Os01g23850.1 downstream_gene_variant ; 3047.0bp to feature; MODIFIER silent_mutation Average:9.249; most accessible tissue: Callus, score: 34.686 N N N N
vg0113419706 C -> A LOC_Os01g23840-LOC_Os01g23850 intergenic_region ; MODIFIER silent_mutation Average:9.249; most accessible tissue: Callus, score: 34.686 N N N N
vg0113419706 C -> DEL N N silent_mutation Average:9.249; most accessible tissue: Callus, score: 34.686 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0113419706 NA 7.65E-06 mr1230 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113419706 NA 3.06E-06 mr1286 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113419706 NA 7.89E-07 mr1420 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113419706 NA 9.27E-09 mr1465 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113419706 3.62E-06 3.61E-06 mr1497 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113419706 NA 1.95E-06 mr1556 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113419706 NA 6.40E-06 mr1665 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113419706 NA 3.37E-08 mr1764 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113419706 NA 6.90E-06 mr1740_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251