\
| Variant ID: vg0113419706 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 13419706 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AGTTTTGTAAGTAGTCTATATTTAATACTCTAAATTAGTGTCTAAAGACAGGGACTAAAGTTAAGTCCCTGGATCTAAACACCACCTAAAACTTTTAAGT[C/A]
CCTATCACATCGGATGTTTGAAAATTAATTATAAATATTAAACGTAGACTATTAATAAAACTCATCCATAATCTTGGACTAATTTGCGAGACGAATCTAA
TTAGATTCGTCTCGCAAATTAGTCCAAGATTATGGATGAGTTTTATTAATAGTCTACGTTTAATATTTATAATTAATTTTCAAACATCCGATGTGATAGG[G/T]
ACTTAAAAGTTTTAGGTGGTGTTTAGATCCAGGGACTTAACTTTAGTCCCTGTCTTTAGACACTAATTTAGAGTATTAAATATAGACTACTTACAAAACT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 62.30% | 0.20% | 26.15% | 11.40% | NA |
| All Indica | 2759 | 42.00% | 0.00% | 40.20% | 17.80% | NA |
| All Japonica | 1512 | 96.80% | 0.00% | 2.71% | 0.46% | NA |
| Aus | 269 | 71.00% | 3.00% | 14.87% | 11.15% | NA |
| Indica I | 595 | 32.40% | 0.00% | 32.94% | 34.62% | NA |
| Indica II | 465 | 46.00% | 0.00% | 48.17% | 5.81% | NA |
| Indica III | 913 | 45.60% | 0.00% | 43.70% | 10.73% | NA |
| Indica Intermediate | 786 | 42.70% | 0.00% | 36.90% | 20.36% | NA |
| Temperate Japonica | 767 | 98.30% | 0.00% | 1.17% | 0.52% | NA |
| Tropical Japonica | 504 | 94.40% | 0.00% | 5.16% | 0.40% | NA |
| Japonica Intermediate | 241 | 97.10% | 0.00% | 2.49% | 0.41% | NA |
| VI/Aromatic | 96 | 65.60% | 0.00% | 28.12% | 6.25% | NA |
| Intermediate | 90 | 73.30% | 0.00% | 21.11% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0113419706 | C -> A | LOC_Os01g23840.1 | upstream_gene_variant ; 4474.0bp to feature; MODIFIER | silent_mutation | Average:9.249; most accessible tissue: Callus, score: 34.686 | N | N | N | N |
| vg0113419706 | C -> A | LOC_Os01g23850.1 | downstream_gene_variant ; 3047.0bp to feature; MODIFIER | silent_mutation | Average:9.249; most accessible tissue: Callus, score: 34.686 | N | N | N | N |
| vg0113419706 | C -> A | LOC_Os01g23840-LOC_Os01g23850 | intergenic_region ; MODIFIER | silent_mutation | Average:9.249; most accessible tissue: Callus, score: 34.686 | N | N | N | N |
| vg0113419706 | C -> DEL | N | N | silent_mutation | Average:9.249; most accessible tissue: Callus, score: 34.686 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0113419706 | NA | 7.65E-06 | mr1230 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113419706 | NA | 3.06E-06 | mr1286 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113419706 | NA | 7.89E-07 | mr1420 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113419706 | NA | 9.27E-09 | mr1465 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113419706 | 3.62E-06 | 3.61E-06 | mr1497 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113419706 | NA | 1.95E-06 | mr1556 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113419706 | NA | 6.40E-06 | mr1665 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113419706 | NA | 3.37E-08 | mr1764 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113419706 | NA | 6.90E-06 | mr1740_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |