Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0113372891:

Variant ID: vg0113372891 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 13372891
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.76, C: 0.24, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:

AATTATTTGATATTAGATCCTTTCTTGATATTCGTATTTTCGTGCGTGGCCAAATTTTCATACGTCGCCAACGATTTTGCTATCGATCACTCGCGTGATT[C/T]
TTTTGCTGACATTTCACGTTTTTTTTGCAGCCTTGTTAGCCGGCGCGTCGGACACCAGCACGTCGGCCTTCGGGTCTAGCTACCCCAAGCGCACACGATA

Reverse complement sequence

TATCGTGTGCGCTTGGGGTAGCTAGACCCGAAGGCCGACGTGCTGGTGTCCGACGCGCCGGCTAACAAGGCTGCAAAAAAAACGTGAAATGTCAGCAAAA[G/A]
AATCACGCGAGTGATCGATAGCAAAATCGTTGGCGACGTATGAAAATTTGGCCACGCACGAAAATACGAATATCAAGAAAGGATCTAATATCAAATAATT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	61.70%	38.20%	0.06%	0.00%	NA
All Indica	2759	89.20%	10.70%	0.11%	0.00%	NA
All Japonica	1512	3.80%	96.20%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.30%	0.70%	0.00%	0.00%	NA
Indica II	465	96.30%	3.20%	0.43%	0.00%	NA
Indica III	913	78.50%	21.50%	0.00%	0.00%	NA
Indica Intermediate	786	89.80%	10.10%	0.13%	0.00%	NA
Temperate Japonica	767	1.80%	98.20%	0.00%	0.00%	NA
Tropical Japonica	504	7.10%	92.90%	0.00%	0.00%	NA
Japonica Intermediate	241	3.30%	96.70%	0.00%	0.00%	NA
VI/Aromatic	96	81.20%	18.80%	0.00%	0.00%	NA
Intermediate	90	54.40%	45.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0113372891	C -> T	LOC_Os01g23780.1	upstream_gene_variant ; 729.0bp to feature; MODIFIER	silent_mutation	Average:61.41; most accessible tissue: Minghui63 young leaf, score: 78.821	N	N	N	N
vg0113372891	C -> T	LOC_Os01g23790.1	downstream_gene_variant ; 1951.0bp to feature; MODIFIER	silent_mutation	Average:61.41; most accessible tissue: Minghui63 young leaf, score: 78.821	N	N	N	N
vg0113372891	C -> T	LOC_Os01g23770-LOC_Os01g23780	intergenic_region ; MODIFIER	silent_mutation	Average:61.41; most accessible tissue: Minghui63 young leaf, score: 78.821	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0113372891	NA	1.88E-80	mr1134	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113372891	NA	8.39E-24	mr1383	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113372891	NA	3.08E-40	mr1480	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113372891	NA	9.60E-67	mr1711	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113372891	NA	1.36E-24	mr1903	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113372891	NA	2.29E-36	mr1932	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113372891	NA	7.21E-52	mr1935	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113372891	NA	2.33E-16	mr1968	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113372891	NA	2.26E-16	mr1146_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113372891	NA	2.48E-20	mr1168_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113372891	NA	3.21E-14	mr1191_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113372891	NA	2.36E-52	mr1261_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113372891	NA	1.56E-06	mr1275_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113372891	NA	2.37E-06	mr1369_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113372891	NA	4.75E-07	mr1453_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113372891	NA	1.51E-17	mr1682_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113372891	NA	3.57E-91	mr1711_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113372891	NA	4.35E-19	mr1712_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113372891	NA	1.53E-13	mr1717_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113372891	NA	1.13E-17	mr1817_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113372891	NA	6.80E-16	mr1836_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113372891	NA	5.23E-15	mr1866_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251