\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0113186086:

Variant ID: vg0113186086 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 13186086
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTTCTAAAAGGAATAATAGAATTAATTAAAATTCAAATAGAAATTGGCAAACATTAAAATGCGTACAAGAAAAATTCGAATGTGGCCTGGAGAATTTTT[G/A]
TTAAATTCCCCTTGGTCTAAAATGAGCCCTCAAATTTTACTTGAATTTTCAGAGCACCGGAAATAATTATTAAACAACAACAACAATTAAGAAAATTTAT

Reverse complement sequence

ATAAATTTTCTTAATTGTTGTTGTTGTTTAATAATTATTTCCGGTGCTCTGAAAATTCAAGTAAAATTTGAGGGCTCATTTTAGACCAAGGGGAATTTAA[C/T]
AAAAATTCTCCAGGCCACATTCGAATTTTTCTTGTACGCATTTTAATGTTTGCCAATTTCTATTTGAATTTTAATTAATTCTATTATTCCTTTTAGAAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.00% 3.50% 9.33% 32.18% NA
All Indica  2759 38.20% 0.10% 14.06% 47.66% NA
All Japonica  1512 86.10% 10.60% 0.13% 3.17% NA
Aus  269 63.20% 0.00% 13.75% 23.05% NA
Indica I  595 17.30% 0.20% 13.45% 69.08% NA
Indica II  465 36.80% 0.00% 18.49% 44.73% NA
Indica III  913 53.60% 0.20% 11.39% 34.83% NA
Indica Intermediate  786 36.90% 0.00% 15.01% 48.09% NA
Temperate Japonica  767 97.90% 1.20% 0.13% 0.78% NA
Tropical Japonica  504 64.10% 29.00% 0.00% 6.94% NA
Japonica Intermediate  241 94.60% 2.10% 0.41% 2.90% NA
VI/Aromatic  96 14.60% 0.00% 7.29% 78.12% NA
Intermediate  90 65.60% 3.30% 7.78% 23.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0113186086 G -> A LOC_Os01g23490.1 upstream_gene_variant ; 2829.0bp to feature; MODIFIER silent_mutation Average:19.505; most accessible tissue: Minghui63 young leaf, score: 31.294 N N N N
vg0113186086 G -> A LOC_Os01g23460.1 downstream_gene_variant ; 3298.0bp to feature; MODIFIER silent_mutation Average:19.505; most accessible tissue: Minghui63 young leaf, score: 31.294 N N N N
vg0113186086 G -> A LOC_Os01g23470.1 downstream_gene_variant ; 579.0bp to feature; MODIFIER silent_mutation Average:19.505; most accessible tissue: Minghui63 young leaf, score: 31.294 N N N N
vg0113186086 G -> A LOC_Os01g23480.1 downstream_gene_variant ; 744.0bp to feature; MODIFIER silent_mutation Average:19.505; most accessible tissue: Minghui63 young leaf, score: 31.294 N N N N
vg0113186086 G -> A LOC_Os01g23470-LOC_Os01g23480 intergenic_region ; MODIFIER silent_mutation Average:19.505; most accessible tissue: Minghui63 young leaf, score: 31.294 N N N N
vg0113186086 G -> DEL N N silent_mutation Average:19.505; most accessible tissue: Minghui63 young leaf, score: 31.294 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0113186086 NA 5.76E-07 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113186086 5.65E-07 1.07E-09 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113186086 5.66E-06 3.07E-06 mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113186086 NA 7.90E-06 mr1949 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113186086 9.56E-06 NA mr1070_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113186086 8.41E-09 8.41E-09 mr1076_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113186086 1.37E-07 1.47E-10 mr1082_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113186086 4.89E-07 1.50E-09 mr1083_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113186086 1.71E-07 6.52E-07 mr1104_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113186086 6.50E-07 9.85E-08 mr1107_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113186086 8.94E-06 1.36E-07 mr1226_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113186086 7.00E-07 7.00E-07 mr1264_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113186086 NA 9.14E-07 mr1408_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251