\
| Variant ID: vg0113186086 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 13186086 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TTTTCTAAAAGGAATAATAGAATTAATTAAAATTCAAATAGAAATTGGCAAACATTAAAATGCGTACAAGAAAAATTCGAATGTGGCCTGGAGAATTTTT[G/A]
TTAAATTCCCCTTGGTCTAAAATGAGCCCTCAAATTTTACTTGAATTTTCAGAGCACCGGAAATAATTATTAAACAACAACAACAATTAAGAAAATTTAT
ATAAATTTTCTTAATTGTTGTTGTTGTTTAATAATTATTTCCGGTGCTCTGAAAATTCAAGTAAAATTTGAGGGCTCATTTTAGACCAAGGGGAATTTAA[C/T]
AAAAATTCTCCAGGCCACATTCGAATTTTTCTTGTACGCATTTTAATGTTTGCCAATTTCTATTTGAATTTTAATTAATTCTATTATTCCTTTTAGAAAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 55.00% | 3.50% | 9.33% | 32.18% | NA |
| All Indica | 2759 | 38.20% | 0.10% | 14.06% | 47.66% | NA |
| All Japonica | 1512 | 86.10% | 10.60% | 0.13% | 3.17% | NA |
| Aus | 269 | 63.20% | 0.00% | 13.75% | 23.05% | NA |
| Indica I | 595 | 17.30% | 0.20% | 13.45% | 69.08% | NA |
| Indica II | 465 | 36.80% | 0.00% | 18.49% | 44.73% | NA |
| Indica III | 913 | 53.60% | 0.20% | 11.39% | 34.83% | NA |
| Indica Intermediate | 786 | 36.90% | 0.00% | 15.01% | 48.09% | NA |
| Temperate Japonica | 767 | 97.90% | 1.20% | 0.13% | 0.78% | NA |
| Tropical Japonica | 504 | 64.10% | 29.00% | 0.00% | 6.94% | NA |
| Japonica Intermediate | 241 | 94.60% | 2.10% | 0.41% | 2.90% | NA |
| VI/Aromatic | 96 | 14.60% | 0.00% | 7.29% | 78.12% | NA |
| Intermediate | 90 | 65.60% | 3.30% | 7.78% | 23.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0113186086 | G -> A | LOC_Os01g23490.1 | upstream_gene_variant ; 2829.0bp to feature; MODIFIER | silent_mutation | Average:19.505; most accessible tissue: Minghui63 young leaf, score: 31.294 | N | N | N | N |
| vg0113186086 | G -> A | LOC_Os01g23460.1 | downstream_gene_variant ; 3298.0bp to feature; MODIFIER | silent_mutation | Average:19.505; most accessible tissue: Minghui63 young leaf, score: 31.294 | N | N | N | N |
| vg0113186086 | G -> A | LOC_Os01g23470.1 | downstream_gene_variant ; 579.0bp to feature; MODIFIER | silent_mutation | Average:19.505; most accessible tissue: Minghui63 young leaf, score: 31.294 | N | N | N | N |
| vg0113186086 | G -> A | LOC_Os01g23480.1 | downstream_gene_variant ; 744.0bp to feature; MODIFIER | silent_mutation | Average:19.505; most accessible tissue: Minghui63 young leaf, score: 31.294 | N | N | N | N |
| vg0113186086 | G -> A | LOC_Os01g23470-LOC_Os01g23480 | intergenic_region ; MODIFIER | silent_mutation | Average:19.505; most accessible tissue: Minghui63 young leaf, score: 31.294 | N | N | N | N |
| vg0113186086 | G -> DEL | N | N | silent_mutation | Average:19.505; most accessible tissue: Minghui63 young leaf, score: 31.294 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0113186086 | NA | 5.76E-07 | mr1082 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113186086 | 5.65E-07 | 1.07E-09 | mr1083 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113186086 | 5.66E-06 | 3.07E-06 | mr1226 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113186086 | NA | 7.90E-06 | mr1949 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113186086 | 9.56E-06 | NA | mr1070_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113186086 | 8.41E-09 | 8.41E-09 | mr1076_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113186086 | 1.37E-07 | 1.47E-10 | mr1082_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113186086 | 4.89E-07 | 1.50E-09 | mr1083_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113186086 | 1.71E-07 | 6.52E-07 | mr1104_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113186086 | 6.50E-07 | 9.85E-08 | mr1107_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113186086 | 8.94E-06 | 1.36E-07 | mr1226_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113186086 | 7.00E-07 | 7.00E-07 | mr1264_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113186086 | NA | 9.14E-07 | mr1408_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |