\
| Variant ID: vg0113185672 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 13185672 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CTCCCCCACAGGATTTTGTATTATCTCGGTATATGTTGATGATCTCAACATCATTGGCAATACACAAGATATTAATGAAGCACGTCATCATTTAAAGACA[G/A]
AATTTGAGATGAAGGATTTGGGTCAAACCAAATTTTGCTTAGGTCTACAACTTGAGCATTTACCTTCTGGAATCCTTGTGCACCAAAGTGCATATACCCA
TGGGTATATGCACTTTGGTGCACAAGGATTCCAGAAGGTAAATGCTCAAGTTGTAGACCTAAGCAAAATTTGGTTTGACCCAAATCCTTCATCTCAAATT[C/T]
TGTCTTTAAATGATGACGTGCTTCATTAATATCTTGTGTATTGCCAATGATGTTGAGATCATCAACATATACCGAGATAATACAAAATCCTGTGGGGGAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 73.80% | 3.20% | 15.57% | 7.51% | NA |
| All Indica | 2759 | 62.80% | 0.10% | 25.05% | 11.96% | NA |
| All Japonica | 1512 | 88.80% | 9.40% | 0.60% | 1.26% | NA |
| Aus | 269 | 94.10% | 0.00% | 5.58% | 0.37% | NA |
| Indica I | 595 | 51.60% | 0.30% | 29.75% | 18.32% | NA |
| Indica II | 465 | 62.20% | 0.00% | 25.16% | 12.69% | NA |
| Indica III | 913 | 74.40% | 0.20% | 19.28% | 6.13% | NA |
| Indica Intermediate | 786 | 58.40% | 0.00% | 28.12% | 13.49% | NA |
| Temperate Japonica | 767 | 98.80% | 1.00% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 69.20% | 25.80% | 1.39% | 3.57% | NA |
| Japonica Intermediate | 241 | 97.50% | 1.70% | 0.41% | 0.41% | NA |
| VI/Aromatic | 96 | 88.50% | 0.00% | 10.42% | 1.04% | NA |
| Intermediate | 90 | 80.00% | 3.30% | 12.22% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0113185672 | G -> A | LOC_Os01g23490.1 | upstream_gene_variant ; 3243.0bp to feature; MODIFIER | silent_mutation | Average:5.859; most accessible tissue: Zhenshan97 young leaf, score: 12.45 | N | N | N | N |
| vg0113185672 | G -> A | LOC_Os01g23460.1 | downstream_gene_variant ; 2884.0bp to feature; MODIFIER | silent_mutation | Average:5.859; most accessible tissue: Zhenshan97 young leaf, score: 12.45 | N | N | N | N |
| vg0113185672 | G -> A | LOC_Os01g23470.1 | downstream_gene_variant ; 165.0bp to feature; MODIFIER | silent_mutation | Average:5.859; most accessible tissue: Zhenshan97 young leaf, score: 12.45 | N | N | N | N |
| vg0113185672 | G -> A | LOC_Os01g23480.1 | downstream_gene_variant ; 1158.0bp to feature; MODIFIER | silent_mutation | Average:5.859; most accessible tissue: Zhenshan97 young leaf, score: 12.45 | N | N | N | N |
| vg0113185672 | G -> A | LOC_Os01g23470-LOC_Os01g23480 | intergenic_region ; MODIFIER | silent_mutation | Average:5.859; most accessible tissue: Zhenshan97 young leaf, score: 12.45 | N | N | N | N |
| vg0113185672 | G -> DEL | N | N | silent_mutation | Average:5.859; most accessible tissue: Zhenshan97 young leaf, score: 12.45 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0113185672 | NA | 5.55E-07 | mr1082 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113185672 | 4.52E-07 | 9.76E-10 | mr1083 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113185672 | 3.14E-06 | 2.51E-06 | mr1226 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113185672 | 8.06E-06 | NA | mr1411 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113185672 | NA | 7.20E-06 | mr1949 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113185672 | 7.99E-06 | NA | mr1070_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113185672 | 7.21E-09 | 7.21E-09 | mr1076_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113185672 | 1.31E-07 | 1.31E-10 | mr1082_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113185672 | 5.63E-07 | 1.68E-09 | mr1083_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113185672 | 1.62E-07 | 6.08E-07 | mr1104_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113185672 | 5.79E-07 | 8.93E-08 | mr1107_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113185672 | 7.92E-06 | 1.23E-07 | mr1226_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113185672 | 7.25E-07 | 7.25E-07 | mr1264_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113185672 | NA | 9.80E-07 | mr1408_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |