\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0113185672:

Variant ID: vg0113185672 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 13185672
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTCCCCCACAGGATTTTGTATTATCTCGGTATATGTTGATGATCTCAACATCATTGGCAATACACAAGATATTAATGAAGCACGTCATCATTTAAAGACA[G/A]
AATTTGAGATGAAGGATTTGGGTCAAACCAAATTTTGCTTAGGTCTACAACTTGAGCATTTACCTTCTGGAATCCTTGTGCACCAAAGTGCATATACCCA

Reverse complement sequence

TGGGTATATGCACTTTGGTGCACAAGGATTCCAGAAGGTAAATGCTCAAGTTGTAGACCTAAGCAAAATTTGGTTTGACCCAAATCCTTCATCTCAAATT[C/T]
TGTCTTTAAATGATGACGTGCTTCATTAATATCTTGTGTATTGCCAATGATGTTGAGATCATCAACATATACCGAGATAATACAAAATCCTGTGGGGGAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.80% 3.20% 15.57% 7.51% NA
All Indica  2759 62.80% 0.10% 25.05% 11.96% NA
All Japonica  1512 88.80% 9.40% 0.60% 1.26% NA
Aus  269 94.10% 0.00% 5.58% 0.37% NA
Indica I  595 51.60% 0.30% 29.75% 18.32% NA
Indica II  465 62.20% 0.00% 25.16% 12.69% NA
Indica III  913 74.40% 0.20% 19.28% 6.13% NA
Indica Intermediate  786 58.40% 0.00% 28.12% 13.49% NA
Temperate Japonica  767 98.80% 1.00% 0.13% 0.00% NA
Tropical Japonica  504 69.20% 25.80% 1.39% 3.57% NA
Japonica Intermediate  241 97.50% 1.70% 0.41% 0.41% NA
VI/Aromatic  96 88.50% 0.00% 10.42% 1.04% NA
Intermediate  90 80.00% 3.30% 12.22% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0113185672 G -> A LOC_Os01g23490.1 upstream_gene_variant ; 3243.0bp to feature; MODIFIER silent_mutation Average:5.859; most accessible tissue: Zhenshan97 young leaf, score: 12.45 N N N N
vg0113185672 G -> A LOC_Os01g23460.1 downstream_gene_variant ; 2884.0bp to feature; MODIFIER silent_mutation Average:5.859; most accessible tissue: Zhenshan97 young leaf, score: 12.45 N N N N
vg0113185672 G -> A LOC_Os01g23470.1 downstream_gene_variant ; 165.0bp to feature; MODIFIER silent_mutation Average:5.859; most accessible tissue: Zhenshan97 young leaf, score: 12.45 N N N N
vg0113185672 G -> A LOC_Os01g23480.1 downstream_gene_variant ; 1158.0bp to feature; MODIFIER silent_mutation Average:5.859; most accessible tissue: Zhenshan97 young leaf, score: 12.45 N N N N
vg0113185672 G -> A LOC_Os01g23470-LOC_Os01g23480 intergenic_region ; MODIFIER silent_mutation Average:5.859; most accessible tissue: Zhenshan97 young leaf, score: 12.45 N N N N
vg0113185672 G -> DEL N N silent_mutation Average:5.859; most accessible tissue: Zhenshan97 young leaf, score: 12.45 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0113185672 NA 5.55E-07 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113185672 4.52E-07 9.76E-10 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113185672 3.14E-06 2.51E-06 mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113185672 8.06E-06 NA mr1411 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113185672 NA 7.20E-06 mr1949 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113185672 7.99E-06 NA mr1070_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113185672 7.21E-09 7.21E-09 mr1076_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113185672 1.31E-07 1.31E-10 mr1082_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113185672 5.63E-07 1.68E-09 mr1083_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113185672 1.62E-07 6.08E-07 mr1104_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113185672 5.79E-07 8.93E-08 mr1107_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113185672 7.92E-06 1.23E-07 mr1226_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113185672 7.25E-07 7.25E-07 mr1264_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113185672 NA 9.80E-07 mr1408_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251