Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0113185672:

Variant ID: vg0113185672 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 13185672
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTCCCCCACAGGATTTTGTATTATCTCGGTATATGTTGATGATCTCAACATCATTGGCAATACACAAGATATTAATGAAGCACGTCATCATTTAAAGACA[G/A]
AATTTGAGATGAAGGATTTGGGTCAAACCAAATTTTGCTTAGGTCTACAACTTGAGCATTTACCTTCTGGAATCCTTGTGCACCAAAGTGCATATACCCA

Reverse complement sequence

TGGGTATATGCACTTTGGTGCACAAGGATTCCAGAAGGTAAATGCTCAAGTTGTAGACCTAAGCAAAATTTGGTTTGACCCAAATCCTTCATCTCAAATT[C/T]
TGTCTTTAAATGATGACGTGCTTCATTAATATCTTGTGTATTGCCAATGATGTTGAGATCATCAACATATACCGAGATAATACAAAATCCTGTGGGGGAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	73.80%	3.20%	15.57%	7.51%	NA
All Indica	2759	62.80%	0.10%	25.05%	11.96%	NA
All Japonica	1512	88.80%	9.40%	0.60%	1.26%	NA
Aus	269	94.10%	0.00%	5.58%	0.37%	NA
Indica I	595	51.60%	0.30%	29.75%	18.32%	NA
Indica II	465	62.20%	0.00%	25.16%	12.69%	NA
Indica III	913	74.40%	0.20%	19.28%	6.13%	NA
Indica Intermediate	786	58.40%	0.00%	28.12%	13.49%	NA
Temperate Japonica	767	98.80%	1.00%	0.13%	0.00%	NA
Tropical Japonica	504	69.20%	25.80%	1.39%	3.57%	NA
Japonica Intermediate	241	97.50%	1.70%	0.41%	0.41%	NA
VI/Aromatic	96	88.50%	0.00%	10.42%	1.04%	NA
Intermediate	90	80.00%	3.30%	12.22%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0113185672	G -> A	LOC_Os01g23490.1	upstream_gene_variant ; 3243.0bp to feature; MODIFIER	silent_mutation	Average:5.859; most accessible tissue: Zhenshan97 young leaf, score: 12.45	N	N	N	N
vg0113185672	G -> A	LOC_Os01g23460.1	downstream_gene_variant ; 2884.0bp to feature; MODIFIER	silent_mutation	Average:5.859; most accessible tissue: Zhenshan97 young leaf, score: 12.45	N	N	N	N
vg0113185672	G -> A	LOC_Os01g23470.1	downstream_gene_variant ; 165.0bp to feature; MODIFIER	silent_mutation	Average:5.859; most accessible tissue: Zhenshan97 young leaf, score: 12.45	N	N	N	N
vg0113185672	G -> A	LOC_Os01g23480.1	downstream_gene_variant ; 1158.0bp to feature; MODIFIER	silent_mutation	Average:5.859; most accessible tissue: Zhenshan97 young leaf, score: 12.45	N	N	N	N
vg0113185672	G -> A	LOC_Os01g23470-LOC_Os01g23480	intergenic_region ; MODIFIER	silent_mutation	Average:5.859; most accessible tissue: Zhenshan97 young leaf, score: 12.45	N	N	N	N
vg0113185672	G -> DEL	N	N	silent_mutation	Average:5.859; most accessible tissue: Zhenshan97 young leaf, score: 12.45	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0113185672	NA	5.55E-07	mr1082	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113185672	4.52E-07	9.76E-10	mr1083	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113185672	3.14E-06	2.51E-06	mr1226	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113185672	8.06E-06	NA	mr1411	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113185672	NA	7.20E-06	mr1949	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113185672	7.99E-06	NA	mr1070_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113185672	7.21E-09	7.21E-09	mr1076_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113185672	1.31E-07	1.31E-10	mr1082_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113185672	5.63E-07	1.68E-09	mr1083_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113185672	1.62E-07	6.08E-07	mr1104_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113185672	5.79E-07	8.93E-08	mr1107_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113185672	7.92E-06	1.23E-07	mr1226_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113185672	7.25E-07	7.25E-07	mr1264_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113185672	NA	9.80E-07	mr1408_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251