\
| Variant ID: vg0113133591 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 13133591 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.57, A: 0.43, others allele: 0.00, population size: 49. )
GACCAATCTTTTGCAGCTGGGCCACTGGGATGGCCGGGGGGAGATGCTTGACTCTATCATCTTTACTGGGCTTGAAACTTGTCACCATTGGCTTCACTTT[A/T]
GTTTTCTTCTTGGGTGTGTCTGTATGTATCTCCAGCTTCTCACCAAGCCCAGTGAAGCGTGGGCTTCTTCTAAGGCCTTCAGTAGAAACTGGGGTTTGAA
TTCAAACCCCAGTTTCTACTGAAGGCCTTAGAAGAAGCCCACGCTTCACTGGGCTTGGTGAGAAGCTGGAGATACATACAGACACACCCAAGAAGAAAAC[T/A]
AAAGTGAAGCCAATGGTGACAAGTTTCAAGCCCAGTAAAGATGATAGAGTCAAGCATCTCCCCCCGGCCATCCCAGTGGCCCAGCTGCAAAAGATTGGTC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 63.60% | 29.30% | 0.04% | 6.96% | NA |
| All Indica | 2759 | 87.50% | 2.00% | 0.07% | 10.44% | NA |
| All Japonica | 1512 | 12.20% | 85.30% | 0.00% | 2.51% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 89.10% | 1.70% | 0.00% | 9.24% | NA |
| Indica II | 465 | 86.50% | 3.20% | 0.00% | 10.32% | NA |
| Indica III | 913 | 86.90% | 0.70% | 0.00% | 12.49% | NA |
| Indica Intermediate | 786 | 87.70% | 3.10% | 0.25% | 9.03% | NA |
| Temperate Japonica | 767 | 1.40% | 97.10% | 0.00% | 1.43% | NA |
| Tropical Japonica | 504 | 31.70% | 63.50% | 0.00% | 4.76% | NA |
| Japonica Intermediate | 241 | 5.40% | 93.40% | 0.00% | 1.24% | NA |
| VI/Aromatic | 96 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 55.60% | 41.10% | 0.00% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0113133591 | A -> T | LOC_Os01g23360.1 | synonymous_variant ; p.Thr527Thr; LOW | synonymous_codon | Average:46.465; most accessible tissue: Zhenshan97 young leaf, score: 69.263 | N | N | N | N |
| vg0113133591 | A -> DEL | LOC_Os01g23360.1 | N | frameshift_variant | Average:46.465; most accessible tissue: Zhenshan97 young leaf, score: 69.263 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0113133591 | NA | 6.15E-75 | mr1018 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113133591 | 1.93E-06 | 2.78E-64 | mr1019 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113133591 | NA | 2.08E-06 | mr1083 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113133591 | NA | 3.13E-69 | mr1489 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113133591 | NA | 2.79E-82 | mr1778 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113133591 | NA | 1.02E-75 | mr1019_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113133591 | NA | 1.95E-06 | mr1082_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113133591 | NA | 8.52E-78 | mr1132_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113133591 | NA | 3.76E-07 | mr1227_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113133591 | NA | 3.39E-58 | mr1261_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113133591 | NA | 2.18E-17 | mr1682_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113133591 | NA | 1.13E-16 | mr1730_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113133591 | NA | 9.71E-76 | mr1778_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |