\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0113106800:

Variant ID: vg0113106800 (JBrowse)Variation Type: INDEL
Chromosome: chr01Position: 13106800
Reference Allele: TAlternative Allele: C,TAG
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.51, T: 0.49, others allele: 0.00, population size: 78. )

Flanking Sequence (100 bp) in Reference Genome:


GGGAAATGTCCGAAGTACCCCGCAACCGCCATCAGGGAGTGATCTGGAGCGTCCACGCCTAACCCTAGGATCAACGGTGATCAGGGGGGTTCGGCCGAAC[T/C,TAG]
TGGGTTGGGCCCTCTTGGCCTGGCCTTCGGTCGGTGGATTCCCTGATCCTTCCTCTATCCATTTTTCGGAGTTTTGGGTTGATTCACTAATGTTTCGAGA

Reverse complement sequence

TCTCGAAACATTAGTGAATCAACCCAAAACTCCGAAAAATGGATAGAGGAAGGATCAGGGAATCCACCGACCGAAGGCCAGGCCAAGAGGGCCCAACCCA[A/G,CTA]
GTTCGGCCGAACCCCCCTGATCACCGTTGATCCTAGGGTTAGGCGTGGACGCTCCAGATCACTCCCTGATGGCGGTTGCGGGGTACTTCGGACATTTCCC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.60% 32.90% 0.47% 6.96% NA
All Indica  2759 86.70% 2.10% 0.80% 10.44% NA
All Japonica  1512 1.50% 96.10% 0.00% 2.45% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 88.90% 1.80% 0.00% 9.24% NA
Indica II  465 86.50% 3.40% 0.22% 9.89% NA
Indica III  913 84.70% 0.90% 2.08% 12.38% NA
Indica Intermediate  786 87.50% 2.80% 0.25% 9.41% NA
Temperate Japonica  767 0.30% 98.30% 0.00% 1.43% NA
Tropical Japonica  504 2.20% 93.30% 0.00% 4.56% NA
Japonica Intermediate  241 3.70% 95.00% 0.00% 1.24% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 51.10% 44.40% 0.00% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0113106800 T -> DEL N N silent_mutation Average:52.536; most accessible tissue: Minghui63 young leaf, score: 72.959 N N N N
vg0113106800 T -> C LOC_Os01g23330.1 intron_variant ; MODIFIER silent_mutation Average:52.536; most accessible tissue: Minghui63 young leaf, score: 72.959 N N N N
vg0113106800 T -> TAG LOC_Os01g23330.1 intron_variant ; MODIFIER N Average:52.536; most accessible tissue: Minghui63 young leaf, score: 72.959 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0113106800 NA 6.59E-81 mr1134 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113106800 8.91E-06 3.73E-12 mr1175 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113106800 NA 2.17E-23 mr1383 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113106800 NA 6.74E-51 mr1935 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113106800 NA 1.51E-07 mr1030_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113106800 NA 6.01E-19 mr1168_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113106800 NA 1.05E-33 mr1448_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113106800 NA 2.96E-30 mr1631_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113106800 NA 4.76E-17 mr1712_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113106800 NA 1.10E-17 mr1817_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113106800 NA 3.53E-15 mr1866_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251