\
| Variant ID: vg0113106800 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr01 | Position: 13106800 |
| Reference Allele: T | Alternative Allele: C,TAG |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.51, T: 0.49, others allele: 0.00, population size: 78. )
GGGAAATGTCCGAAGTACCCCGCAACCGCCATCAGGGAGTGATCTGGAGCGTCCACGCCTAACCCTAGGATCAACGGTGATCAGGGGGGTTCGGCCGAAC[T/C,TAG]
TGGGTTGGGCCCTCTTGGCCTGGCCTTCGGTCGGTGGATTCCCTGATCCTTCCTCTATCCATTTTTCGGAGTTTTGGGTTGATTCACTAATGTTTCGAGA
TCTCGAAACATTAGTGAATCAACCCAAAACTCCGAAAAATGGATAGAGGAAGGATCAGGGAATCCACCGACCGAAGGCCAGGCCAAGAGGGCCCAACCCA[A/G,CTA]
GTTCGGCCGAACCCCCCTGATCACCGTTGATCCTAGGGTTAGGCGTGGACGCTCCAGATCACTCCCTGATGGCGGTTGCGGGGTACTTCGGACATTTCCC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 59.60% | 32.90% | 0.47% | 6.96% | NA |
| All Indica | 2759 | 86.70% | 2.10% | 0.80% | 10.44% | NA |
| All Japonica | 1512 | 1.50% | 96.10% | 0.00% | 2.45% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 88.90% | 1.80% | 0.00% | 9.24% | NA |
| Indica II | 465 | 86.50% | 3.40% | 0.22% | 9.89% | NA |
| Indica III | 913 | 84.70% | 0.90% | 2.08% | 12.38% | NA |
| Indica Intermediate | 786 | 87.50% | 2.80% | 0.25% | 9.41% | NA |
| Temperate Japonica | 767 | 0.30% | 98.30% | 0.00% | 1.43% | NA |
| Tropical Japonica | 504 | 2.20% | 93.30% | 0.00% | 4.56% | NA |
| Japonica Intermediate | 241 | 3.70% | 95.00% | 0.00% | 1.24% | NA |
| VI/Aromatic | 96 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 51.10% | 44.40% | 0.00% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0113106800 | T -> DEL | N | N | silent_mutation | Average:52.536; most accessible tissue: Minghui63 young leaf, score: 72.959 | N | N | N | N |
| vg0113106800 | T -> C | LOC_Os01g23330.1 | intron_variant ; MODIFIER | silent_mutation | Average:52.536; most accessible tissue: Minghui63 young leaf, score: 72.959 | N | N | N | N |
| vg0113106800 | T -> TAG | LOC_Os01g23330.1 | intron_variant ; MODIFIER | N | Average:52.536; most accessible tissue: Minghui63 young leaf, score: 72.959 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0113106800 | NA | 6.59E-81 | mr1134 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113106800 | 8.91E-06 | 3.73E-12 | mr1175 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113106800 | NA | 2.17E-23 | mr1383 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113106800 | NA | 6.74E-51 | mr1935 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113106800 | NA | 1.51E-07 | mr1030_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113106800 | NA | 6.01E-19 | mr1168_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113106800 | NA | 1.05E-33 | mr1448_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113106800 | NA | 2.96E-30 | mr1631_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113106800 | NA | 4.76E-17 | mr1712_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113106800 | NA | 1.10E-17 | mr1817_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113106800 | NA | 3.53E-15 | mr1866_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |