\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0113087370:

Variant ID: vg0113087370 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 13087370
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.80, T: 0.20, others allele: 0.00, population size: 74. )

Flanking Sequence (100 bp) in Reference Genome:


GCAGGCTGATTCCATAGAAATTCAGAATTCCCCGAAAAAATCTTGAGGTTGGAAGGGAGAAACCGCCATAGAAGAAATGAGCAAATACCACGATTTCATG[T/C]
GTATCGGGGGTTGGGAATGCTTCGCCGAATGCCGGTCACCACCCGATGATCTCCTTCGCTGGAAGAACGCCGTGCGCCACCATCTCCTTCAGATTATCTT

Reverse complement sequence

AAGATAATCTGAAGGAGATGGTGGCGCACGGCGTTCTTCCAGCGAAGGAGATCATCGGGTGGTGACCGGCATTCGGCGAAGCATTCCCAACCCCCGATAC[A/G]
CATGAAATCGTGGTATTTGCTCATTTCTTCTATGGCGGTTTCTCCCTTCCAACCTCAAGATTTTTTCGGGGAATTCTGAATTTCTATGGAATCAGCCTGC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 31.40% 3.80% 5.35% 59.39% NA
All Indica  2759 5.00% 0.30% 7.97% 86.73% NA
All Japonica  1512 85.60% 10.90% 0.46% 3.04% NA
Aus  269 2.60% 0.00% 8.18% 89.22% NA
Indica I  595 5.90% 0.00% 3.19% 90.92% NA
Indica II  465 6.50% 0.90% 12.69% 80.00% NA
Indica III  913 2.80% 0.40% 7.34% 89.38% NA
Indica Intermediate  786 5.90% 0.10% 9.54% 84.48% NA
Temperate Japonica  767 97.40% 1.20% 0.00% 1.43% NA
Tropical Japonica  504 63.90% 29.60% 0.99% 5.56% NA
Japonica Intermediate  241 93.40% 2.90% 0.83% 2.90% NA
VI/Aromatic  96 6.20% 2.10% 1.04% 90.62% NA
Intermediate  90 45.60% 5.60% 3.33% 45.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0113087370 T -> DEL N N silent_mutation Average:10.115; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg0113087370 T -> C LOC_Os01g23290.1 upstream_gene_variant ; 3616.0bp to feature; MODIFIER silent_mutation Average:10.115; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg0113087370 T -> C LOC_Os01g23310.1 upstream_gene_variant ; 2870.0bp to feature; MODIFIER silent_mutation Average:10.115; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg0113087370 T -> C LOC_Os01g23300.1 downstream_gene_variant ; 681.0bp to feature; MODIFIER silent_mutation Average:10.115; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg0113087370 T -> C LOC_Os01g23300-LOC_Os01g23310 intergenic_region ; MODIFIER silent_mutation Average:10.115; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0113087370 1.36E-06 NA mr1076 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113087370 2.17E-06 NA mr1082 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113087370 NA 1.70E-06 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113087370 3.05E-09 NA mr1083 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113087370 NA 1.05E-08 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113087370 1.33E-06 NA mr1085 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113087370 1.63E-06 NA mr1103 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113087370 3.68E-08 NA mr1107 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113087370 2.66E-08 NA mr1226 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113087370 NA 8.92E-10 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113087370 4.80E-08 NA mr1411 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113087370 3.64E-06 NA mr1560 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113087370 1.20E-07 1.95E-12 mr1949 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113087370 NA 8.92E-06 mr1949 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113087370 9.21E-08 NA mr1070_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113087370 4.71E-06 4.71E-06 mr1076_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113087370 8.06E-12 NA mr1082_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113087370 NA 9.07E-08 mr1082_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113087370 4.53E-13 NA mr1083_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113087370 NA 3.44E-07 mr1083_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113087370 7.79E-09 NA mr1085_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113087370 1.94E-10 NA mr1103_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113087370 8.68E-11 NA mr1104_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113087370 1.13E-09 NA mr1107_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113087370 5.00E-07 NA mr1145_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113087370 6.28E-06 NA mr1224_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113087370 4.64E-09 NA mr1226_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113087370 NA 7.22E-06 mr1226_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113087370 2.25E-06 NA mr1227_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113087370 2.65E-11 NA mr1264_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113087370 1.57E-07 7.79E-13 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113087370 7.67E-07 NA mr1437_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113087370 2.77E-06 NA mr1620_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113087370 NA 8.48E-07 mr1696_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113087370 3.74E-06 NA mr1878_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113087370 1.44E-07 NA mr1949_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251