\
| Variant ID: vg0113081699 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 13081699 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.65, T: 0.35, others allele: 0.00, population size: 54. )
CATTGATGAGGTCAAGAGCAGCTTCTTCGCTCATCCCATCTGCAAAGCCATCAATGGCATCAATGTCAACTCTTGGATAAAGGGATTTGGTCATCGCCAA[T/C]
GCCAGACTTGCTCCCATACTTCCAACTTCTTTGATGTTCTTGAAGTAAGTATCCGGAGCGACTCTCAGCTTGTCGAAGATTTCGGCAACATCAAGTGTAC
GTACACTTGATGTTGCCGAAATCTTCGACAAGCTGAGAGTCGCTCCGGATACTTACTTCAAGAACATCAAAGAAGTTGGAAGTATGGGAGCAAGTCTGGC[A/G]
TTGGCGATGACCAAATCCCTTTATCCAAGAGTTGACATTGATGCCATTGATGGCTTTGCAGATGGGATGAGCGAAGAAGCTGCTCTTGACCTCATCAATG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 40.20% | 3.60% | 36.67% | 19.55% | NA |
| All Indica | 2759 | 13.70% | 0.10% | 54.37% | 31.82% | NA |
| All Japonica | 1512 | 87.80% | 10.80% | 1.06% | 0.33% | NA |
| Aus | 269 | 45.40% | 0.00% | 51.67% | 2.97% | NA |
| Indica I | 595 | 7.10% | 0.00% | 53.28% | 39.66% | NA |
| Indica II | 465 | 9.20% | 0.20% | 49.68% | 40.86% | NA |
| Indica III | 913 | 17.70% | 0.20% | 58.05% | 23.99% | NA |
| Indica Intermediate | 786 | 16.70% | 0.00% | 53.69% | 29.64% | NA |
| Temperate Japonica | 767 | 97.90% | 1.20% | 0.65% | 0.26% | NA |
| Tropical Japonica | 504 | 68.80% | 29.60% | 1.39% | 0.20% | NA |
| Japonica Intermediate | 241 | 95.40% | 2.10% | 1.66% | 0.83% | NA |
| VI/Aromatic | 96 | 26.00% | 0.00% | 55.21% | 18.75% | NA |
| Intermediate | 90 | 52.20% | 3.30% | 27.78% | 16.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0113081699 | T -> DEL | LOC_Os01g23290.1 | N | frameshift_variant | Average:12.465; most accessible tissue: Zhenshan97 young leaf, score: 18.918 | N | N | N | N |
| vg0113081699 | T -> C | LOC_Os01g23290.1 | synonymous_variant ; p.Ala523Ala; LOW | synonymous_codon | Average:12.465; most accessible tissue: Zhenshan97 young leaf, score: 18.918 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0113081699 | NA | 4.51E-07 | mr1082 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113081699 | NA | 4.02E-09 | mr1083 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113081699 | NA | 3.95E-06 | mr1226 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113081699 | NA | 4.23E-06 | mr1949 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113081699 | 5.81E-06 | 5.81E-06 | mr1076_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113081699 | 1.12E-06 | NA | mr1082_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113081699 | NA | 4.93E-08 | mr1082_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113081699 | 3.81E-06 | NA | mr1083_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113081699 | NA | 2.95E-07 | mr1083_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113081699 | 1.40E-07 | NA | mr1103_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113081699 | 2.61E-08 | NA | mr1104_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113081699 | 5.48E-07 | NA | mr1107_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113081699 | 6.06E-06 | NA | mr1226_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113081699 | NA | 2.49E-06 | mr1226_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113081699 | NA | 1.35E-07 | mr1227_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113081699 | 1.38E-06 | NA | mr1264_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |