\
| Variant ID: vg0113034093 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 13034093 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 108. )
GCCGGAGAACCAAACTGGGAGGAATTTACCACAGCCTTCCGTGACAACTTCGTGCCTGCTGCGGTGATGCGGATGAAGAAGAATGAGTTCAGGAGACTAC[A/G]
GCAAGGGAATACCACAGTACAAGAGTACCTGAACCGTTTCACTCAGCTGGCGCGCTACGCGACTAGAGATCTTGCCGACGAGGAGGAAAAGATCGACAAA
TTTGTCGATCTTTTCCTCCTCGTCGGCAAGATCTCTAGTCGCGTAGCGCGCCAGCTGAGTGAAACGGTTCAGGTACTCTTGTACTGTGGTATTCCCTTGC[T/C]
GTAGTCTCCTGAACTCATTCTTCTTCATCCGCATCACCGCAGCAGGCACGAAGTTGTCACGGAAGGCTGTGGTAAATTCCTCCCAGTTTGGTTCTCCGGC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 44.90% | 44.20% | 7.43% | 3.39% | NA |
| All Indica | 2759 | 66.20% | 27.10% | 6.27% | 0.47% | NA |
| All Japonica | 1512 | 11.20% | 77.70% | 1.39% | 9.66% | NA |
| Aus | 269 | 27.10% | 28.60% | 44.24% | 0.00% | NA |
| Indica I | 595 | 35.00% | 50.60% | 13.28% | 1.18% | NA |
| Indica II | 465 | 60.40% | 33.30% | 5.38% | 0.86% | NA |
| Indica III | 913 | 93.50% | 4.70% | 1.75% | 0.00% | NA |
| Indica Intermediate | 786 | 61.50% | 31.60% | 6.74% | 0.25% | NA |
| Temperate Japonica | 767 | 18.00% | 80.70% | 0.39% | 0.91% | NA |
| Tropical Japonica | 504 | 5.20% | 64.90% | 3.17% | 26.79% | NA |
| Japonica Intermediate | 241 | 2.50% | 95.00% | 0.83% | 1.66% | NA |
| VI/Aromatic | 96 | 30.20% | 32.30% | 37.50% | 0.00% | NA |
| Intermediate | 90 | 28.90% | 67.80% | 2.22% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0113034093 | A -> G | LOC_Os01g23200.1 | missense_variant ; p.Gln124Arg; MODERATE | nonsynonymous_codon ; Q124W | Average:7.868; most accessible tissue: Minghui63 panicle, score: 16.27 | probably damaging |
2.97 |
DELETERIOUS | 0.00 |
| vg0113034093 | A -> G | LOC_Os01g23200.1 | missense_variant ; p.Gln124Arg; MODERATE | nonsynonymous_codon ; Q124R | Average:7.868; most accessible tissue: Minghui63 panicle, score: 16.27 | benign |
-0.436 |
TOLERATED | 0.64 |
| vg0113034093 | A -> DEL | LOC_Os01g23200.1 | N | frameshift_variant | Average:7.868; most accessible tissue: Minghui63 panicle, score: 16.27 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0113034093 | NA | 3.67E-11 | Plant_height | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0113034093 | NA | 2.01E-06 | mr1164 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113034093 | NA | 1.04E-09 | mr1648 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113034093 | NA | 4.19E-09 | mr1648 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113034093 | NA | 8.76E-22 | mr1010_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113034093 | NA | 3.04E-09 | mr1030_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113034093 | NA | 2.84E-06 | mr1030_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113034093 | NA | 2.92E-13 | mr1035_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113034093 | 1.56E-07 | 2.36E-11 | mr1164_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113034093 | NA | 4.05E-06 | mr1380_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113034093 | NA | 2.02E-06 | mr1561_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113034093 | NA | 2.19E-09 | mr1576_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113034093 | NA | 4.23E-09 | mr1709_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0113034093 | NA | 4.20E-06 | mr1875_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |