\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0113011816:

Variant ID: vg0113011816 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 13011816
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.77, A: 0.23, others allele: 0.00, population size: 43. )

Flanking Sequence (100 bp) in Reference Genome:


TCCAAGATGAGGAACTAACTTCTCAAGAGTCGTAGTCTTCGCCTCGTTCCTGAGATGGATTCTCTGCAATGCGAATTTATCGGCATTTGAGCAAAGTGGC[T/A]
AATAGGTTGATTGAAGCTGTGTATAAGGAGGCTTACATTTACGAGGCGAGTAGCTTGGCCGAGTGCCTTTTTCAGCAGGCATACTTCCTCATCTTCCTTT

Reverse complement sequence

AAAGGAAGATGAGGAAGTATGCCTGCTGAAAAAGGCACTCGGCCAAGCTACTCGCCTCGTAAATGTAAGCCTCCTTATACACAGCTTCAATCAACCTATT[A/T]
GCCACTTTGCTCAAATGCCGATAAATTCGCATTGCAGAGAATCCATCTCAGGAACGAGGCGAAGACTACGACTCTTGAGAAGTTAGTTCCTCATCTTGGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 44.20% 4.90% 1.57% 49.26% NA
All Indica  2759 26.70% 0.70% 1.96% 70.61% NA
All Japonica  1512 80.50% 11.20% 0.86% 7.41% NA
Aus  269 24.50% 0.00% 2.23% 73.23% NA
Indica I  595 49.90% 0.30% 1.34% 48.40% NA
Indica II  465 31.00% 2.20% 1.51% 65.38% NA
Indica III  913 5.70% 0.30% 1.31% 92.66% NA
Indica Intermediate  786 31.00% 0.60% 3.44% 64.89% NA
Temperate Japonica  767 95.40% 1.70% 0.78% 2.09% NA
Tropical Japonica  504 59.10% 29.80% 0.40% 10.71% NA
Japonica Intermediate  241 77.60% 2.90% 2.07% 17.43% NA
VI/Aromatic  96 19.80% 33.30% 0.00% 46.88% NA
Intermediate  90 57.80% 12.20% 1.11% 28.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0113011816 T -> A LOC_Os01g23130.1 upstream_gene_variant ; 2166.0bp to feature; MODIFIER silent_mutation Average:12.409; most accessible tissue: Zhenshan97 young leaf, score: 25.214 N N N N
vg0113011816 T -> A LOC_Os01g23144.1 intron_variant ; MODIFIER silent_mutation Average:12.409; most accessible tissue: Zhenshan97 young leaf, score: 25.214 N N N N
vg0113011816 T -> DEL N N silent_mutation Average:12.409; most accessible tissue: Zhenshan97 young leaf, score: 25.214 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0113011816 5.95E-07 NA mr1076 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113011816 1.70E-06 NA mr1082 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113011816 NA 4.51E-07 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113011816 7.33E-08 NA mr1083 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113011816 NA 4.02E-09 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113011816 6.97E-06 NA mr1085 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113011816 8.79E-09 NA mr1107 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113011816 5.28E-07 NA mr1226 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113011816 NA 3.95E-06 mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113011816 NA 3.82E-09 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113011816 1.36E-07 NA mr1411 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113011816 NA 3.09E-06 mr1742 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113011816 1.43E-08 2.60E-13 mr1949 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113011816 NA 4.23E-06 mr1949 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113011816 5.81E-06 5.81E-06 mr1076_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113011816 1.70E-09 NA mr1082_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113011816 NA 4.93E-08 mr1082_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113011816 7.96E-09 NA mr1083_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113011816 NA 2.95E-07 mr1083_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113011816 2.27E-06 NA mr1085_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113011816 1.09E-06 NA mr1103_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113011816 8.90E-10 NA mr1104_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113011816 4.74E-09 NA mr1107_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113011816 2.13E-07 NA mr1226_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113011816 NA 2.49E-06 mr1226_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113011816 1.10E-08 NA mr1264_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113011816 NA 2.75E-10 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251