Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0113011816:

Variant ID: vg0113011816 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 13011816
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.77, A: 0.23, others allele: 0.00, population size: 43. )

Flanking Sequence (100 bp) in Reference Genome:

TCCAAGATGAGGAACTAACTTCTCAAGAGTCGTAGTCTTCGCCTCGTTCCTGAGATGGATTCTCTGCAATGCGAATTTATCGGCATTTGAGCAAAGTGGC[T/A]
AATAGGTTGATTGAAGCTGTGTATAAGGAGGCTTACATTTACGAGGCGAGTAGCTTGGCCGAGTGCCTTTTTCAGCAGGCATACTTCCTCATCTTCCTTT

Reverse complement sequence

AAAGGAAGATGAGGAAGTATGCCTGCTGAAAAAGGCACTCGGCCAAGCTACTCGCCTCGTAAATGTAAGCCTCCTTATACACAGCTTCAATCAACCTATT[A/T]
GCCACTTTGCTCAAATGCCGATAAATTCGCATTGCAGAGAATCCATCTCAGGAACGAGGCGAAGACTACGACTCTTGAGAAGTTAGTTCCTCATCTTGGA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	44.20%	4.90%	1.57%	49.26%	NA
All Indica	2759	26.70%	0.70%	1.96%	70.61%	NA
All Japonica	1512	80.50%	11.20%	0.86%	7.41%	NA
Aus	269	24.50%	0.00%	2.23%	73.23%	NA
Indica I	595	49.90%	0.30%	1.34%	48.40%	NA
Indica II	465	31.00%	2.20%	1.51%	65.38%	NA
Indica III	913	5.70%	0.30%	1.31%	92.66%	NA
Indica Intermediate	786	31.00%	0.60%	3.44%	64.89%	NA
Temperate Japonica	767	95.40%	1.70%	0.78%	2.09%	NA
Tropical Japonica	504	59.10%	29.80%	0.40%	10.71%	NA
Japonica Intermediate	241	77.60%	2.90%	2.07%	17.43%	NA
VI/Aromatic	96	19.80%	33.30%	0.00%	46.88%	NA
Intermediate	90	57.80%	12.20%	1.11%	28.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0113011816	T -> A	LOC_Os01g23130.1	upstream_gene_variant ; 2166.0bp to feature; MODIFIER	silent_mutation	Average:12.409; most accessible tissue: Zhenshan97 young leaf, score: 25.214	N	N	N	N
vg0113011816	T -> A	LOC_Os01g23144.1	intron_variant ; MODIFIER	silent_mutation	Average:12.409; most accessible tissue: Zhenshan97 young leaf, score: 25.214	N	N	N	N
vg0113011816	T -> DEL	N	N	silent_mutation	Average:12.409; most accessible tissue: Zhenshan97 young leaf, score: 25.214	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0113011816	5.95E-07	NA	mr1076	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113011816	1.70E-06	NA	mr1082	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113011816	NA	4.51E-07	mr1082	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113011816	7.33E-08	NA	mr1083	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113011816	NA	4.02E-09	mr1083	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113011816	6.97E-06	NA	mr1085	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113011816	8.79E-09	NA	mr1107	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113011816	5.28E-07	NA	mr1226	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113011816	NA	3.95E-06	mr1226	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113011816	NA	3.82E-09	mr1408	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113011816	1.36E-07	NA	mr1411	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113011816	NA	3.09E-06	mr1742	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113011816	1.43E-08	2.60E-13	mr1949	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113011816	NA	4.23E-06	mr1949	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113011816	5.81E-06	5.81E-06	mr1076_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113011816	1.70E-09	NA	mr1082_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113011816	NA	4.93E-08	mr1082_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113011816	7.96E-09	NA	mr1083_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113011816	NA	2.95E-07	mr1083_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113011816	2.27E-06	NA	mr1085_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113011816	1.09E-06	NA	mr1103_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113011816	8.90E-10	NA	mr1104_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113011816	4.74E-09	NA	mr1107_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113011816	2.13E-07	NA	mr1226_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113011816	NA	2.49E-06	mr1226_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113011816	1.10E-08	NA	mr1264_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113011816	NA	2.75E-10	mr1408_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251