\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0112972548:

Variant ID: vg0112972548 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 12972548
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGACTGACTCGTTTTGAAAAACTCACTTTAAACGAGCGACCAAGATTTTCCCTTGAACCACCAGAACAGATCCCCATTTTCCCGGAACAAATCCAATTGC[G/A]
AAGAACATATGCAATGAAAAAGGATTCAGAGGGCTCTTAGGTTTTTCCATTTGGCTTGTCCTACGGTCAAGGTCGGCTCTGATACCAACTTGTCACGCCC

Reverse complement sequence

GGGCGTGACAAGTTGGTATCAGAGCCGACCTTGACCGTAGGACAAGCCAAATGGAAAAACCTAAGAGCCCTCTGAATCCTTTTTCATTGCATATGTTCTT[C/T]
GCAATTGGATTTGTTCCGGGAAAATGGGGATCTGTTCTGGTGGTTCAAGGGAAAATCTTGGTCGCTCGTTTAAAGTGAGTTTTTCAAAACGAGTCAGTCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 35.20% 0.80% 24.97% 39.06% NA
All Indica  2759 6.50% 0.90% 31.64% 60.93% NA
All Japonica  1512 82.50% 0.50% 12.24% 4.76% NA
Aus  269 59.50% 0.40% 21.56% 18.59% NA
Indica I  595 7.10% 0.30% 20.17% 72.44% NA
Indica II  465 4.10% 1.30% 33.33% 61.29% NA
Indica III  913 5.00% 1.90% 41.62% 51.48% NA
Indica Intermediate  786 9.20% 0.10% 27.74% 62.98% NA
Temperate Japonica  767 90.90% 0.10% 7.82% 1.17% NA
Tropical Japonica  504 64.30% 1.00% 22.82% 11.90% NA
Japonica Intermediate  241 94.20% 0.40% 4.15% 1.24% NA
VI/Aromatic  96 28.10% 2.10% 47.92% 21.88% NA
Intermediate  90 55.60% 0.00% 20.00% 24.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0112972548 G -> A LOC_Os01g23040.1 upstream_gene_variant ; 3632.0bp to feature; MODIFIER silent_mutation Average:8.331; most accessible tissue: Callus, score: 16.161 N N N N
vg0112972548 G -> A LOC_Os01g23050.1 upstream_gene_variant ; 24.0bp to feature; MODIFIER silent_mutation Average:8.331; most accessible tissue: Callus, score: 16.161 N N N N
vg0112972548 G -> A LOC_Os01g23060.1 upstream_gene_variant ; 1977.0bp to feature; MODIFIER silent_mutation Average:8.331; most accessible tissue: Callus, score: 16.161 N N N N
vg0112972548 G -> A LOC_Os01g23050-LOC_Os01g23060 intergenic_region ; MODIFIER silent_mutation Average:8.331; most accessible tissue: Callus, score: 16.161 N N N N
vg0112972548 G -> DEL N N silent_mutation Average:8.331; most accessible tissue: Callus, score: 16.161 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0112972548 NA 2.52E-10 mr1712 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112972548 6.61E-06 NA mr1082_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112972548 NA 1.67E-06 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112972548 NA 5.38E-06 mr1910_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112972548 NA 1.10E-08 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251