\
| Variant ID: vg0112972548 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 12972548 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AGACTGACTCGTTTTGAAAAACTCACTTTAAACGAGCGACCAAGATTTTCCCTTGAACCACCAGAACAGATCCCCATTTTCCCGGAACAAATCCAATTGC[G/A]
AAGAACATATGCAATGAAAAAGGATTCAGAGGGCTCTTAGGTTTTTCCATTTGGCTTGTCCTACGGTCAAGGTCGGCTCTGATACCAACTTGTCACGCCC
GGGCGTGACAAGTTGGTATCAGAGCCGACCTTGACCGTAGGACAAGCCAAATGGAAAAACCTAAGAGCCCTCTGAATCCTTTTTCATTGCATATGTTCTT[C/T]
GCAATTGGATTTGTTCCGGGAAAATGGGGATCTGTTCTGGTGGTTCAAGGGAAAATCTTGGTCGCTCGTTTAAAGTGAGTTTTTCAAAACGAGTCAGTCT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 35.20% | 0.80% | 24.97% | 39.06% | NA |
| All Indica | 2759 | 6.50% | 0.90% | 31.64% | 60.93% | NA |
| All Japonica | 1512 | 82.50% | 0.50% | 12.24% | 4.76% | NA |
| Aus | 269 | 59.50% | 0.40% | 21.56% | 18.59% | NA |
| Indica I | 595 | 7.10% | 0.30% | 20.17% | 72.44% | NA |
| Indica II | 465 | 4.10% | 1.30% | 33.33% | 61.29% | NA |
| Indica III | 913 | 5.00% | 1.90% | 41.62% | 51.48% | NA |
| Indica Intermediate | 786 | 9.20% | 0.10% | 27.74% | 62.98% | NA |
| Temperate Japonica | 767 | 90.90% | 0.10% | 7.82% | 1.17% | NA |
| Tropical Japonica | 504 | 64.30% | 1.00% | 22.82% | 11.90% | NA |
| Japonica Intermediate | 241 | 94.20% | 0.40% | 4.15% | 1.24% | NA |
| VI/Aromatic | 96 | 28.10% | 2.10% | 47.92% | 21.88% | NA |
| Intermediate | 90 | 55.60% | 0.00% | 20.00% | 24.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0112972548 | G -> A | LOC_Os01g23040.1 | upstream_gene_variant ; 3632.0bp to feature; MODIFIER | silent_mutation | Average:8.331; most accessible tissue: Callus, score: 16.161 | N | N | N | N |
| vg0112972548 | G -> A | LOC_Os01g23050.1 | upstream_gene_variant ; 24.0bp to feature; MODIFIER | silent_mutation | Average:8.331; most accessible tissue: Callus, score: 16.161 | N | N | N | N |
| vg0112972548 | G -> A | LOC_Os01g23060.1 | upstream_gene_variant ; 1977.0bp to feature; MODIFIER | silent_mutation | Average:8.331; most accessible tissue: Callus, score: 16.161 | N | N | N | N |
| vg0112972548 | G -> A | LOC_Os01g23050-LOC_Os01g23060 | intergenic_region ; MODIFIER | silent_mutation | Average:8.331; most accessible tissue: Callus, score: 16.161 | N | N | N | N |
| vg0112972548 | G -> DEL | N | N | silent_mutation | Average:8.331; most accessible tissue: Callus, score: 16.161 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0112972548 | NA | 2.52E-10 | mr1712 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112972548 | 6.61E-06 | NA | mr1082_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112972548 | NA | 1.67E-06 | mr1227_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112972548 | NA | 5.38E-06 | mr1910_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112972548 | NA | 1.10E-08 | mr1940_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |