Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0112941979:

Variant ID: vg0112941979 (JBrowse)	Variation Type: INDEL
Chromosome: chr01	Position: 12941979
Reference Allele: A	Alternative Allele: G,AATATG
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.01, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:

CAATCTCATCATCCATAGGTAACTATTACTACATAGTATGTTCCAAATTATAAGATGGTTTGGTCTTTCCATCCCTGATTTAAATTACTAACATCCATAT[A/G,AATATG]
AATTTGGACACATATACGAAACATATACATGGATCCATACATGAATTTATTCAAAACCCAAAACACGAGGAAGTAAATCTTATACTACAATTTATAATAT

Reverse complement sequence

ATATTATAAATTGTAGTATAAGATTTACTTCCTCGTGTTTTGGGTTTTGAATAAATTCATGTATGGATCCATGTATATGTTTCGTATATGTGTCCAAATT[T/C,CATATT]
ATATGGATGTTAGTAATTTAAATCAGGGATGGAAAGACCAAACCATCTTATAATTTGGAACATACTATGTAGTAATAGTTACCTATGGATGATGAGATTG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	71.20%	28.70%	0.00%	0.00%	AATATG: 0.02%
All Indica	2759	99.10%	0.90%	0.00%	0.00%	NA
All Japonica	1512	14.50%	85.50%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.50%	0.50%	0.00%	0.00%	NA
Indica II	465	97.80%	2.20%	0.00%	0.00%	NA
Indica III	913	99.80%	0.20%	0.00%	0.00%	NA
Indica Intermediate	786	98.60%	1.40%	0.00%	0.00%	NA
Temperate Japonica	767	3.00%	97.00%	0.00%	0.00%	NA
Tropical Japonica	504	36.10%	63.90%	0.00%	0.00%	NA
Japonica Intermediate	241	5.80%	94.20%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	57.80%	41.10%	0.00%	0.00%	AATATG: 1.11%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0112941979	A -> G	LOC_Os01g23010.1	upstream_gene_variant ; 3744.0bp to feature; MODIFIER	silent_mutation	Average:43.449; most accessible tissue: Callus, score: 67.313	N	N	N	N
vg0112941979	A -> G	LOC_Os01g23000-LOC_Os01g23010	intergenic_region ; MODIFIER	silent_mutation	Average:43.449; most accessible tissue: Callus, score: 67.313	N	N	N	N
vg0112941979	A -> AATATG	LOC_Os01g23010.1	upstream_gene_variant ; 3743.0bp to feature; MODIFIER	silent_mutation	Average:43.449; most accessible tissue: Callus, score: 67.313	N	N	N	N
vg0112941979	A -> AATATG	LOC_Os01g23000-LOC_Os01g23010	intergenic_region ; MODIFIER	silent_mutation	Average:43.449; most accessible tissue: Callus, score: 67.313	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0112941979	NA	1.20E-77	mr1018	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112941979	2.01E-06	2.82E-66	mr1019	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112941979	NA	2.31E-08	mr1019	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112941979	NA	2.04E-06	mr1083	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112941979	NA	7.25E-71	mr1132	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112941979	NA	4.69E-61	mr1142	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112941979	NA	2.56E-55	mr1178	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112941979	NA	7.62E-73	mr1489	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112941979	NA	2.93E-51	mr1490	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112941979	NA	1.47E-61	mr1491	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112941979	NA	7.15E-85	mr1778	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112941979	NA	1.72E-78	mr1019_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112941979	NA	1.96E-07	mr1030_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112941979	NA	4.12E-06	mr1082_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112941979	5.66E-06	NA	mr1104_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112941979	NA	1.38E-83	mr1132_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112941979	NA	5.41E-07	mr1227_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112941979	3.91E-06	3.42E-62	mr1261_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112941979	NA	3.04E-81	mr1489_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112941979	NA	2.56E-08	mr1576_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112941979	NA	9.51E-18	mr1682_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112941979	NA	9.43E-17	mr1712_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112941979	NA	3.70E-84	mr1778_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251