\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0112941979:

Variant ID: vg0112941979 (JBrowse)Variation Type: INDEL
Chromosome: chr01Position: 12941979
Reference Allele: AAlternative Allele: G,AATATG
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.01, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:


CAATCTCATCATCCATAGGTAACTATTACTACATAGTATGTTCCAAATTATAAGATGGTTTGGTCTTTCCATCCCTGATTTAAATTACTAACATCCATAT[A/G,AATATG]
AATTTGGACACATATACGAAACATATACATGGATCCATACATGAATTTATTCAAAACCCAAAACACGAGGAAGTAAATCTTATACTACAATTTATAATAT

Reverse complement sequence

ATATTATAAATTGTAGTATAAGATTTACTTCCTCGTGTTTTGGGTTTTGAATAAATTCATGTATGGATCCATGTATATGTTTCGTATATGTGTCCAAATT[T/C,CATATT]
ATATGGATGTTAGTAATTTAAATCAGGGATGGAAAGACCAAACCATCTTATAATTTGGAACATACTATGTAGTAATAGTTACCTATGGATGATGAGATTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.20% 28.70% 0.00% 0.00% AATATG: 0.02%
All Indica  2759 99.10% 0.90% 0.00% 0.00% NA
All Japonica  1512 14.50% 85.50% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.50% 0.50% 0.00% 0.00% NA
Indica II  465 97.80% 2.20% 0.00% 0.00% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 98.60% 1.40% 0.00% 0.00% NA
Temperate Japonica  767 3.00% 97.00% 0.00% 0.00% NA
Tropical Japonica  504 36.10% 63.90% 0.00% 0.00% NA
Japonica Intermediate  241 5.80% 94.20% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 57.80% 41.10% 0.00% 0.00% AATATG: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0112941979 A -> G LOC_Os01g23010.1 upstream_gene_variant ; 3744.0bp to feature; MODIFIER silent_mutation Average:43.449; most accessible tissue: Callus, score: 67.313 N N N N
vg0112941979 A -> G LOC_Os01g23000-LOC_Os01g23010 intergenic_region ; MODIFIER silent_mutation Average:43.449; most accessible tissue: Callus, score: 67.313 N N N N
vg0112941979 A -> AATATG LOC_Os01g23010.1 upstream_gene_variant ; 3743.0bp to feature; MODIFIER silent_mutation Average:43.449; most accessible tissue: Callus, score: 67.313 N N N N
vg0112941979 A -> AATATG LOC_Os01g23000-LOC_Os01g23010 intergenic_region ; MODIFIER silent_mutation Average:43.449; most accessible tissue: Callus, score: 67.313 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0112941979 NA 1.20E-77 mr1018 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112941979 2.01E-06 2.82E-66 mr1019 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112941979 NA 2.31E-08 mr1019 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112941979 NA 2.04E-06 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112941979 NA 7.25E-71 mr1132 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112941979 NA 4.69E-61 mr1142 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112941979 NA 2.56E-55 mr1178 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112941979 NA 7.62E-73 mr1489 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112941979 NA 2.93E-51 mr1490 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112941979 NA 1.47E-61 mr1491 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112941979 NA 7.15E-85 mr1778 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112941979 NA 1.72E-78 mr1019_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112941979 NA 1.96E-07 mr1030_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112941979 NA 4.12E-06 mr1082_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112941979 5.66E-06 NA mr1104_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112941979 NA 1.38E-83 mr1132_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112941979 NA 5.41E-07 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112941979 3.91E-06 3.42E-62 mr1261_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112941979 NA 3.04E-81 mr1489_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112941979 NA 2.56E-08 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112941979 NA 9.51E-18 mr1682_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112941979 NA 9.43E-17 mr1712_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112941979 NA 3.70E-84 mr1778_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251