\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0112931554:

Variant ID: vg0112931554 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 12931554
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.90, C: 0.09, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


ACAAACTTTGTATATGACGTGTGTGAACTTTATATACATATGTATTAAAAAATCGAAAAAACAAAAAAACATCACATATATAAACTTTAATACGTGTATA[C/T]
AAACTTTGTATATGTACGTATATAAACTAGTTTATATACACACATACAAAATTTGTATACGTATGTATACAAACTCGTATAAAAAAAATTGTATACATAT

Reverse complement sequence

ATATGTATACAATTTTTTTTATACGAGTTTGTATACATACGTATACAAATTTTGTATGTGTGTATATAAACTAGTTTATATACGTACATATACAAAGTTT[G/A]
TATACACGTATTAAAGTTTATATATGTGATGTTTTTTTGTTTTTTCGATTTTTTAATACATATGTATATAAAGTTCACACACGTCATATACAAAGTTTGT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.10% 29.00% 2.88% 0.00% NA
All Indica  2759 95.40% 1.10% 3.48% 0.00% NA
All Japonica  1512 11.20% 86.10% 2.65% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 88.90% 0.50% 10.59% 0.00% NA
Indica II  465 97.20% 2.60% 0.22% 0.00% NA
Indica III  913 97.70% 0.40% 1.86% 0.00% NA
Indica Intermediate  786 96.60% 1.50% 1.91% 0.00% NA
Temperate Japonica  767 19.30% 78.50% 2.22% 0.00% NA
Tropical Japonica  504 2.40% 93.70% 3.97% 0.00% NA
Japonica Intermediate  241 4.10% 94.60% 1.24% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 61.10% 38.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0112931554 C -> T LOC_Os01g23000.1 downstream_gene_variant ; 857.0bp to feature; MODIFIER silent_mutation Average:36.112; most accessible tissue: Callus, score: 84.741 N N N N
vg0112931554 C -> T LOC_Os01g22990-LOC_Os01g23000 intergenic_region ; MODIFIER silent_mutation Average:36.112; most accessible tissue: Callus, score: 84.741 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0112931554 NA 2.24E-15 mr1035 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112931554 NA 3.81E-14 mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112931554 NA 5.69E-12 mr1170 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112931554 3.07E-06 3.29E-13 mr1175 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112931554 NA 2.43E-07 mr1510 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112931554 NA 1.33E-12 mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112931554 7.91E-06 6.02E-12 mr1648 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112931554 NA 7.11E-09 mr1648 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112931554 NA 7.73E-14 mr1740 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112931554 NA 1.43E-06 mr1761 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112931554 NA 9.78E-10 mr1030_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112931554 NA 1.73E-13 mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112931554 NA 1.22E-08 mr1164_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112931554 NA 6.30E-06 mr1355_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112931554 NA 2.05E-07 mr1358_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112931554 NA 4.77E-06 mr1452_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112931554 NA 6.85E-10 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112931554 NA 3.22E-29 mr1631_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112931554 NA 4.74E-12 mr1666_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112931554 NA 4.21E-08 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112931554 NA 1.38E-16 mr1712_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112931554 NA 5.88E-09 mr1749_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112931554 NA 4.50E-13 mr1761_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112931554 NA 7.34E-18 mr1817_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112931554 NA 9.27E-09 mr1821_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112931554 NA 7.84E-17 mr1836_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112931554 NA 1.56E-06 mr1875_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251