\
| Variant ID: vg0112881406 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 12881406 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TGTTGAGGGTAGGTAAAATGGTAGAAGTTGGTTTTTTTGGAACAAAATTCAAATTCTAGAAGTTGAGTTTTTTTGGGACGGAGGGAGTATGTCCAAAGTC[G/A]
TAGTAGGATGTGTCACATTTAGTATTAGATTGGTTTTCTACGGGACAAAGGGAGTAACCAACATATTTAACAAATATTATAATTTTAATATTTAATAATA
TATTATTAAATATTAAAATTATAATATTTGTTAAATATGTTGGTTACTCCCTTTGTCCCGTAGAAAACCAATCTAATACTAAATGTGACACATCCTACTA[C/T]
GACTTTGGACATACTCCCTCCGTCCCAAAAAAACTCAACTTCTAGAATTTGAATTTTGTTCCAAAAAAACCAACTTCTACCATTTTACCTACCCTCAACA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 85.00% | 14.80% | 0.15% | 0.00% | NA |
| All Indica | 2759 | 88.90% | 11.10% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 91.30% | 8.30% | 0.40% | 0.00% | NA |
| Aus | 269 | 6.70% | 93.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 83.50% | 16.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 84.70% | 15.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 77.20% | 21.80% | 0.99% | 0.00% | NA |
| Japonica Intermediate | 241 | 94.20% | 5.40% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 81.10% | 17.80% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0112881406 | G -> A | LOC_Os01g22920.1 | downstream_gene_variant ; 3068.0bp to feature; MODIFIER | silent_mutation | Average:32.507; most accessible tissue: Zhenshan97 panicle, score: 63.607 | N | N | N | N |
| vg0112881406 | G -> A | LOC_Os01g22910.1 | intron_variant ; MODIFIER | silent_mutation | Average:32.507; most accessible tissue: Zhenshan97 panicle, score: 63.607 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0112881406 | NA | 8.98E-08 | mr1530 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112881406 | NA | 1.48E-11 | mr1696 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112881406 | NA | 4.41E-10 | mr1047_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112881406 | 2.96E-06 | NA | mr1134_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112881406 | NA | 2.33E-06 | mr1456_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112881406 | NA | 5.07E-17 | mr1530_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112881406 | NA | 6.37E-07 | mr1792_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112881406 | NA | 6.57E-13 | mr1803_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112881406 | NA | 2.60E-08 | mr1808_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112881406 | NA | 9.82E-07 | mr1815_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112881406 | NA | 3.47E-06 | mr1850_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |