Variant ID: vg0112839994 (JBrowse) | Variation Type: SNP |
Chromosome: chr01 | Position: 12839994 |
Reference Allele: G | Alternative Allele: C |
Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 336. )
TCTGGAATCTTGAATCGGTTAGGCAAAGGAACTCTCTCAAACCACTTGGGGTAAGGATGCCGATACAAATTTCTAGCATCTTTCGGCTTAAGCCCGAACT[G/C]
TTCTCTCATTACATCTGCGATCATATTGGCCCATGGTCGTTGTTGAGGCGCTCCTTGTACTTGTTGTGGCACGGGCTCAAATTGATTGTATTGTGGAACA
TGTTCCACAATACAATCAATTTGAGCCCGTGCCACAACAAGTACAAGGAGCGCCTCAACAACGACCATGGGCCAATATGATCGCAGATGTAATGAGAGAA[C/G]
AGTTCGGGCTTAAGCCGAAAGATGCTAGAAATTTGTATCGGCATCCTTACCCCAAGTGGTTTGAGAGAGTTCCTTTGCCTAACCGATTCAAGATTCCAGA
Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 96.10% | 3.70% | 0.19% | 0.00% | NA |
All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
All Japonica | 1512 | 88.30% | 11.10% | 0.60% | 0.00% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 94.30% | 5.10% | 0.65% | 0.00% | NA |
Tropical Japonica | 504 | 74.60% | 24.60% | 0.79% | 0.00% | NA |
Japonica Intermediate | 241 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0112839994 | G -> C | LOC_Os01g22850.1 | missense_variant ; p.Gln89Glu; MODERATE | nonsynonymous_codon ; Q89E | Average:58.691; most accessible tissue: Zhenshan97 young leaf, score: 74.302 | benign | 1.184 | DELETERIOUS | 0.00 |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0112839994 | 2.49E-06 | 2.35E-07 | mr1076 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0112839994 | NA | 1.64E-07 | mr1082 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0112839994 | 1.37E-07 | 7.95E-11 | mr1083 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0112839994 | NA | 3.18E-06 | mr1226 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0112839994 | 3.40E-06 | 5.95E-08 | mr1408 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0112839994 | NA | 3.89E-06 | mr1949 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0112839994 | NA | 8.50E-08 | mr1082_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |