Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0112831041:

Variant ID: vg0112831041 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 12831041
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGTTTCGGCTATCCAGTGTTTTTTGTCTCAGTAACATTCTGTGTAATAGAATCTAGGAATTTTTGTAATCGGCTAAGAAACTCTGACTCTTTATGTAACT[C/T]
ATCTTAATAACTTTTATGCCGATTCAATGTAACTCCACATTTTGCTCGAAAATTTGCAATTTCTCATATATATGTGCCCCCTTAATTTTATAATGTCAAA

Reverse complement sequence

TTTGACATTATAAAATTAAGGGGGCACATATATATGAGAAATTGCAAATTTTCGAGCAAAATGTGGAGTTACATTGAATCGGCATAAAAGTTATTAAGAT[G/A]
AGTTACATAAAGAGTCAGAGTTTCTTAGCCGATTACAAAAATTCCTAGATTCTATTACACAGAATGTTACTGAGACAAAAAACACTGGATAGCCGAAACA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	95.60%	3.70%	0.49%	0.19%	NA
All Indica	2759	99.10%	0.10%	0.40%	0.33%	NA
All Japonica	1512	88.30%	10.90%	0.79%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	99.50%	0.00%	0.50%	0.00%	NA
Indica II	465	98.50%	0.20%	0.22%	1.08%	NA
Indica III	913	99.80%	0.10%	0.00%	0.11%	NA
Indica Intermediate	786	98.50%	0.30%	0.89%	0.38%	NA
Temperate Japonica	767	94.30%	4.80%	0.91%	0.00%	NA
Tropical Japonica	504	74.60%	24.40%	0.99%	0.00%	NA
Japonica Intermediate	241	97.90%	2.10%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	95.60%	4.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0112831041	C -> T	LOC_Os01g22830.1	downstream_gene_variant ; 67.0bp to feature; MODIFIER	silent_mutation	Average:33.491; most accessible tissue: Minghui63 young leaf, score: 51.901	N	N	N	N
vg0112831041	C -> T	LOC_Os01g22840.1	downstream_gene_variant ; 961.0bp to feature; MODIFIER	silent_mutation	Average:33.491; most accessible tissue: Minghui63 young leaf, score: 51.901	N	N	N	N
vg0112831041	C -> T	LOC_Os01g22830-LOC_Os01g22840	intergenic_region ; MODIFIER	silent_mutation	Average:33.491; most accessible tissue: Minghui63 young leaf, score: 51.901	N	N	N	N
vg0112831041	C -> DEL	N	N	silent_mutation	Average:33.491; most accessible tissue: Minghui63 young leaf, score: 51.901	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0112831041	NA	3.08E-06	mr1076	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112831041	NA	3.24E-07	mr1082	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112831041	8.87E-07	2.58E-09	mr1083	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112831041	NA	2.30E-06	mr1408	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112831041	9.21E-07	9.21E-07	mr1076_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112831041	3.64E-08	6.49E-10	mr1082_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112831041	NA	3.00E-07	mr1083_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112831041	NA	9.06E-06	mr1103_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112831041	5.04E-06	1.53E-06	mr1104_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112831041	NA	2.96E-06	mr1107_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112831041	NA	1.88E-06	mr1226_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112831041	2.79E-06	2.79E-06	mr1264_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251