\
| Variant ID: vg0112795014 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 12795014 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TCCACCCCCCTTACAAGAATCTCGTCCCCGAGATTCGAGGAGGCTAGCAAGAAGATAGGTTGGGCGGTCTTCTCTTCTTGTCTGACTTCTTCCGCTCCGT[C/T]
TTCTTATAACAAACTTGCCTAGCACAACTTCTCCACTCTGGACTGCTTGGCTCGATCTCCTGTTGCAGATGGAATCTTCTCTTCACCTGACTTGTCCCTG
CAGGGACAAGTCAGGTGAAGAGAAGATTCCATCTGCAACAGGAGATCGAGCCAAGCAGTCCAGAGTGGAGAAGTTGTGCTAGGCAAGTTTGTTATAAGAA[G/A]
ACGGAGCGGAAGAAGTCAGACAAGAAGAGAAGACCGCCCAACCTATCTTCTTGCTAGCCTCCTCGAATCTCGGGGACGAGATTCTTGTAAGGGGGGTGGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 26.50% | 0.30% | 4.85% | 68.35% | NA |
| All Indica | 2759 | 1.50% | 0.20% | 2.17% | 96.12% | NA |
| All Japonica | 1512 | 77.50% | 0.10% | 8.60% | 13.82% | NA |
| Aus | 269 | 0.00% | 2.20% | 0.74% | 97.03% | NA |
| Indica I | 595 | 1.00% | 0.00% | 2.52% | 96.47% | NA |
| Indica II | 465 | 3.20% | 0.90% | 1.29% | 94.62% | NA |
| Indica III | 913 | 0.70% | 0.00% | 2.96% | 96.39% | NA |
| Indica Intermediate | 786 | 1.90% | 0.10% | 1.53% | 96.44% | NA |
| Temperate Japonica | 767 | 74.40% | 0.10% | 10.69% | 14.73% | NA |
| Tropical Japonica | 504 | 74.60% | 0.00% | 8.33% | 17.06% | NA |
| Japonica Intermediate | 241 | 93.40% | 0.00% | 2.49% | 4.15% | NA |
| VI/Aromatic | 96 | 6.20% | 0.00% | 30.21% | 63.54% | NA |
| Intermediate | 90 | 37.80% | 1.10% | 8.89% | 52.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0112795014 | C -> T | LOC_Os01g22750.1 | upstream_gene_variant ; 3319.0bp to feature; MODIFIER | silent_mutation | Average:6.713; most accessible tissue: Callus, score: 17.257 | N | N | N | N |
| vg0112795014 | C -> T | LOC_Os01g22760.1 | downstream_gene_variant ; 2181.0bp to feature; MODIFIER | silent_mutation | Average:6.713; most accessible tissue: Callus, score: 17.257 | N | N | N | N |
| vg0112795014 | C -> T | LOC_Os01g22750-LOC_Os01g22760 | intergenic_region ; MODIFIER | silent_mutation | Average:6.713; most accessible tissue: Callus, score: 17.257 | N | N | N | N |
| vg0112795014 | C -> DEL | N | N | silent_mutation | Average:6.713; most accessible tissue: Callus, score: 17.257 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0112795014 | 4.26E-08 | 1.74E-22 | mr1498 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112795014 | 8.61E-07 | 1.98E-21 | mr1769 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112795014 | NA | 4.28E-09 | mr1925 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112795014 | 9.37E-08 | 2.08E-17 | mr1951 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112795014 | NA | 2.75E-08 | mr1310_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112795014 | NA | 3.14E-16 | mr1498_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112795014 | NA | 6.11E-21 | mr1769_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112795014 | NA | 3.60E-06 | mr1916_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112795014 | NA | 2.75E-08 | mr1925_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112795014 | NA | 3.56E-13 | mr1951_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |