\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0112795014:

Variant ID: vg0112795014 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 12795014
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCCACCCCCCTTACAAGAATCTCGTCCCCGAGATTCGAGGAGGCTAGCAAGAAGATAGGTTGGGCGGTCTTCTCTTCTTGTCTGACTTCTTCCGCTCCGT[C/T]
TTCTTATAACAAACTTGCCTAGCACAACTTCTCCACTCTGGACTGCTTGGCTCGATCTCCTGTTGCAGATGGAATCTTCTCTTCACCTGACTTGTCCCTG

Reverse complement sequence

CAGGGACAAGTCAGGTGAAGAGAAGATTCCATCTGCAACAGGAGATCGAGCCAAGCAGTCCAGAGTGGAGAAGTTGTGCTAGGCAAGTTTGTTATAAGAA[G/A]
ACGGAGCGGAAGAAGTCAGACAAGAAGAGAAGACCGCCCAACCTATCTTCTTGCTAGCCTCCTCGAATCTCGGGGACGAGATTCTTGTAAGGGGGGTGGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 26.50% 0.30% 4.85% 68.35% NA
All Indica  2759 1.50% 0.20% 2.17% 96.12% NA
All Japonica  1512 77.50% 0.10% 8.60% 13.82% NA
Aus  269 0.00% 2.20% 0.74% 97.03% NA
Indica I  595 1.00% 0.00% 2.52% 96.47% NA
Indica II  465 3.20% 0.90% 1.29% 94.62% NA
Indica III  913 0.70% 0.00% 2.96% 96.39% NA
Indica Intermediate  786 1.90% 0.10% 1.53% 96.44% NA
Temperate Japonica  767 74.40% 0.10% 10.69% 14.73% NA
Tropical Japonica  504 74.60% 0.00% 8.33% 17.06% NA
Japonica Intermediate  241 93.40% 0.00% 2.49% 4.15% NA
VI/Aromatic  96 6.20% 0.00% 30.21% 63.54% NA
Intermediate  90 37.80% 1.10% 8.89% 52.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0112795014 C -> T LOC_Os01g22750.1 upstream_gene_variant ; 3319.0bp to feature; MODIFIER silent_mutation Average:6.713; most accessible tissue: Callus, score: 17.257 N N N N
vg0112795014 C -> T LOC_Os01g22760.1 downstream_gene_variant ; 2181.0bp to feature; MODIFIER silent_mutation Average:6.713; most accessible tissue: Callus, score: 17.257 N N N N
vg0112795014 C -> T LOC_Os01g22750-LOC_Os01g22760 intergenic_region ; MODIFIER silent_mutation Average:6.713; most accessible tissue: Callus, score: 17.257 N N N N
vg0112795014 C -> DEL N N silent_mutation Average:6.713; most accessible tissue: Callus, score: 17.257 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0112795014 4.26E-08 1.74E-22 mr1498 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112795014 8.61E-07 1.98E-21 mr1769 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112795014 NA 4.28E-09 mr1925 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112795014 9.37E-08 2.08E-17 mr1951 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112795014 NA 2.75E-08 mr1310_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112795014 NA 3.14E-16 mr1498_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112795014 NA 6.11E-21 mr1769_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112795014 NA 3.60E-06 mr1916_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112795014 NA 2.75E-08 mr1925_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112795014 NA 3.56E-13 mr1951_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251