\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0112778994:

Variant ID: vg0112778994 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 12778994
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.02, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:


CAACTGAATTCCTCCTTGCCCTATAAGCCATGATCTTTGATATGTCAACTCCATATTTTCTCATAACTGCATCCATCATAGAAGTGATTTTTCAGTTTGG[G/A]
TCACTTCTAATGTCCTGTTCATACACTTTACTTAACCATTCACTAGTCACTCTGCTACTGTCCATAGTTGTACCACATGTGTGAGGACCAACCATATTCC

Reverse complement sequence

GGAATATGGTTGGTCCTCACACATGTGGTACAACTATGGACAGTAGCAGAGTGACTAGTGAATGGTTAAGTAAAGTGTATGAACAGGACATTAGAAGTGA[C/T]
CCAAACTGAAAAATCACTTCTATGATGGATGCAGTTATGAGAAAATATGGAGTTGACATATCAAAGATCATGGCTTATAGGGCAAGGAGGAATTCAGTTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.40% 40.30% 0.04% 0.25% NA
All Indica  2759 35.20% 64.40% 0.04% 0.43% NA
All Japonica  1512 96.80% 3.20% 0.00% 0.00% NA
Aus  269 92.90% 7.10% 0.00% 0.00% NA
Indica I  595 29.20% 70.60% 0.00% 0.17% NA
Indica II  465 41.30% 58.70% 0.00% 0.00% NA
Indica III  913 34.20% 65.20% 0.11% 0.55% NA
Indica Intermediate  786 37.20% 62.10% 0.00% 0.76% NA
Temperate Japonica  767 98.30% 1.70% 0.00% 0.00% NA
Tropical Japonica  504 93.70% 6.30% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 1.70% 0.00% 0.00% NA
VI/Aromatic  96 60.40% 39.60% 0.00% 0.00% NA
Intermediate  90 75.60% 23.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0112778994 G -> A LOC_Os01g22730.1 upstream_gene_variant ; 25.0bp to feature; MODIFIER silent_mutation Average:44.743; most accessible tissue: Zhenshan97 young leaf, score: 67.334 N N N N
vg0112778994 G -> A LOC_Os01g22740.1 upstream_gene_variant ; 2700.0bp to feature; MODIFIER silent_mutation Average:44.743; most accessible tissue: Zhenshan97 young leaf, score: 67.334 N N N N
vg0112778994 G -> A LOC_Os01g22730-LOC_Os01g22740 intergenic_region ; MODIFIER silent_mutation Average:44.743; most accessible tissue: Zhenshan97 young leaf, score: 67.334 N N N N
vg0112778994 G -> DEL N N silent_mutation Average:44.743; most accessible tissue: Zhenshan97 young leaf, score: 67.334 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0112778994 NA 2.16E-09 mr1151 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112778994 NA 6.67E-10 mr1352 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112778994 NA 2.69E-09 mr1881 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112778994 NA 1.27E-07 mr1654_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251