\
| Variant ID: vg0112713543 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 12713543 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CAAATTATATATAGACGACCCCTTTCTCCTATGATTTTTACTCACATCTTCTTGCCATATATCAAAATCTATACCTACTTAAAAAATTCGTAAGGCTTCC[G/A]
GTAGATGATTTTTGTCCGTCTTGGTCCATCATCCGCATCACGTGTACCTCCTCTCCGCTTCATATGTCAATGCGCGTCCCCTCTGAAGATCCCACAACCA
TGGTTGTGGGATCTTCAGAGGGGACGCGCATTGACATATGAAGCGGAGAGGAGGTACACGTGATGCGGATGATGGACCAAGACGGACAAAAATCATCTAC[C/T]
GGAAGCCTTACGAATTTTTTAAGTAGGTATAGATTTTGATATATGGCAAGAAGATGTGAGTAAAAATCATAGGAGAAAGGGGTCGTCTATATATAATTTG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 97.30% | 2.60% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 92.30% | 7.50% | 0.20% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 97.50% | 2.20% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 86.70% | 13.30% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 87.60% | 12.00% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0112713543 | G -> A | LOC_Os01g22600.1 | upstream_gene_variant ; 3735.0bp to feature; MODIFIER | silent_mutation | Average:52.254; most accessible tissue: Callus, score: 74.078 | N | N | N | N |
| vg0112713543 | G -> A | LOC_Os01g22600-LOC_Os01g22620 | intergenic_region ; MODIFIER | silent_mutation | Average:52.254; most accessible tissue: Callus, score: 74.078 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0112713543 | NA | 8.10E-06 | mr1411 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112713543 | 2.56E-06 | 1.42E-07 | mr1560 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112713543 | NA | 2.31E-06 | mr1068_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112713543 | NA | 3.23E-06 | mr1078_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112713543 | NA | 2.43E-07 | mr1091_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112713543 | NA | 1.51E-06 | mr1096_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112713543 | NA | 8.88E-06 | mr1112_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112713543 | NA | 2.47E-06 | mr1211_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |