\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0112713543:

Variant ID: vg0112713543 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 12713543
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAAATTATATATAGACGACCCCTTTCTCCTATGATTTTTACTCACATCTTCTTGCCATATATCAAAATCTATACCTACTTAAAAAATTCGTAAGGCTTCC[G/A]
GTAGATGATTTTTGTCCGTCTTGGTCCATCATCCGCATCACGTGTACCTCCTCTCCGCTTCATATGTCAATGCGCGTCCCCTCTGAAGATCCCACAACCA

Reverse complement sequence

TGGTTGTGGGATCTTCAGAGGGGACGCGCATTGACATATGAAGCGGAGAGGAGGTACACGTGATGCGGATGATGGACCAAGACGGACAAAAATCATCTAC[C/T]
GGAAGCCTTACGAATTTTTTAAGTAGGTATAGATTTTGATATATGGCAAGAAGATGTGAGTAAAAATCATAGGAGAAAGGGGTCGTCTATATATAATTTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.30% 2.60% 0.06% 0.00% NA
All Indica  2759 99.80% 0.20% 0.00% 0.00% NA
All Japonica  1512 92.30% 7.50% 0.20% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.90% 0.10% 0.00% 0.00% NA
Temperate Japonica  767 97.50% 2.20% 0.26% 0.00% NA
Tropical Japonica  504 86.70% 13.30% 0.00% 0.00% NA
Japonica Intermediate  241 87.60% 12.00% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 95.60% 4.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0112713543 G -> A LOC_Os01g22600.1 upstream_gene_variant ; 3735.0bp to feature; MODIFIER silent_mutation Average:52.254; most accessible tissue: Callus, score: 74.078 N N N N
vg0112713543 G -> A LOC_Os01g22600-LOC_Os01g22620 intergenic_region ; MODIFIER silent_mutation Average:52.254; most accessible tissue: Callus, score: 74.078 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0112713543 NA 8.10E-06 mr1411 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112713543 2.56E-06 1.42E-07 mr1560 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112713543 NA 2.31E-06 mr1068_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112713543 NA 3.23E-06 mr1078_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112713543 NA 2.43E-07 mr1091_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112713543 NA 1.51E-06 mr1096_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112713543 NA 8.88E-06 mr1112_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112713543 NA 2.47E-06 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251