\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0112635655:

Variant ID: vg0112635655 (JBrowse)Variation Type: INDEL
Chromosome: chr01Position: 12635655
Reference Allele: AAlternative Allele: T,ATTT,ATT,AT
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.94, T: 0.08, others allele: 0.00, population size: 63. )

Flanking Sequence (100 bp) in Reference Genome:


TCTAGATAAGTGTTCCATATTTTCATTAGAAATTTCCATACTTTTAGGTTTATCAGTCCCTCAACAGGATATTCGCTGATTCCTTCGGCCGAAAAATTCA[A/T,ATTT,ATT,AT]
TTTTTTTTCATTTAGCAAAATTTCCCCCAAAAATTTCCAAAACTCCAGCAATTCCAGTTACATCAATCCCCCATAAATGTTTTTTATTTCCATGATACTG

Reverse complement sequence

CAGTATCATGGAAATAAAAAACATTTATGGGGGATTGATGTAACTGGAATTGCTGGAGTTTTGGAAATTTTTGGGGGAAATTTTGCTAAATGAAAAAAAA[T/A,AAAT,AAT,AT]
TGAATTTTTCGGCCGAAGGAATCAGCGAATATCCTGTTGAGGGACTGATAAACCTAAAAGTATGGAAATTTCTAATGAAAATATGGAACACTTATCTAGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 31.40% 21.10% 0.32% 44.31% ATTT: 2.75%; ATT: 0.08%; AT: 0.02%
All Indica  2759 4.20% 19.70% 0.51% 71.33% ATTT: 4.20%; ATT: 0.04%
All Japonica  1512 83.80% 13.20% 0.07% 2.71% ATTT: 0.20%
Aus  269 0.70% 81.00% 0.00% 14.87% ATTT: 2.97%; AT: 0.37%
Indica I  595 4.40% 4.40% 0.84% 90.25% ATTT: 0.17%
Indica II  465 4.50% 46.90% 0.65% 44.95% ATTT: 3.01%
Indica III  913 3.90% 11.20% 0.22% 77.11% ATTT: 7.56%
Indica Intermediate  786 4.20% 25.20% 0.51% 65.90% ATTT: 4.07%; ATT: 0.13%
Temperate Japonica  767 93.00% 6.00% 0.13% 0.91% NA
Tropical Japonica  504 71.60% 21.80% 0.00% 5.95% ATTT: 0.60%
Japonica Intermediate  241 80.10% 18.30% 0.00% 1.66% NA
VI/Aromatic  96 62.50% 11.50% 0.00% 26.04% NA
Intermediate  90 45.60% 25.60% 0.00% 22.22% ATTT: 3.33%; ATT: 3.33%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0112635655 A -> AT LOC_Os01g22480.1 downstream_gene_variant ; 787.0bp to feature; MODIFIER silent_mutation Average:35.244; most accessible tissue: Minghui63 flag leaf, score: 67.099 N N N N
vg0112635655 A -> AT LOC_Os01g22480.2 downstream_gene_variant ; 724.0bp to feature; MODIFIER silent_mutation Average:35.244; most accessible tissue: Minghui63 flag leaf, score: 67.099 N N N N
vg0112635655 A -> AT LOC_Os01g22450-LOC_Os01g22480 intergenic_region ; MODIFIER silent_mutation Average:35.244; most accessible tissue: Minghui63 flag leaf, score: 67.099 N N N N
vg0112635655 A -> T LOC_Os01g22480.1 downstream_gene_variant ; 788.0bp to feature; MODIFIER silent_mutation Average:35.244; most accessible tissue: Minghui63 flag leaf, score: 67.099 N N N N
vg0112635655 A -> T LOC_Os01g22480.2 downstream_gene_variant ; 725.0bp to feature; MODIFIER silent_mutation Average:35.244; most accessible tissue: Minghui63 flag leaf, score: 67.099 N N N N
vg0112635655 A -> T LOC_Os01g22450-LOC_Os01g22480 intergenic_region ; MODIFIER silent_mutation Average:35.244; most accessible tissue: Minghui63 flag leaf, score: 67.099 N N N N
vg0112635655 A -> ATT LOC_Os01g22480.1 downstream_gene_variant ; 787.0bp to feature; MODIFIER silent_mutation Average:35.244; most accessible tissue: Minghui63 flag leaf, score: 67.099 N N N N
vg0112635655 A -> ATT LOC_Os01g22480.2 downstream_gene_variant ; 724.0bp to feature; MODIFIER silent_mutation Average:35.244; most accessible tissue: Minghui63 flag leaf, score: 67.099 N N N N
vg0112635655 A -> ATT LOC_Os01g22450-LOC_Os01g22480 intergenic_region ; MODIFIER silent_mutation Average:35.244; most accessible tissue: Minghui63 flag leaf, score: 67.099 N N N N
vg0112635655 A -> ATTT LOC_Os01g22480.1 downstream_gene_variant ; 787.0bp to feature; MODIFIER silent_mutation Average:35.244; most accessible tissue: Minghui63 flag leaf, score: 67.099 N N N N
vg0112635655 A -> ATTT LOC_Os01g22480.2 downstream_gene_variant ; 724.0bp to feature; MODIFIER silent_mutation Average:35.244; most accessible tissue: Minghui63 flag leaf, score: 67.099 N N N N
vg0112635655 A -> ATTT LOC_Os01g22450-LOC_Os01g22480 intergenic_region ; MODIFIER silent_mutation Average:35.244; most accessible tissue: Minghui63 flag leaf, score: 67.099 N N N N
vg0112635655 A -> DEL N N silent_mutation Average:35.244; most accessible tissue: Minghui63 flag leaf, score: 67.099 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0112635655 NA 3.25E-06 mr1333 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112635655 NA 6.00E-06 mr1457_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112635655 NA 8.65E-06 mr1961_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251