\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0112504974:

Variant ID: vg0112504974 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 12504974
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:


CCTCGGGCAAGACGGCGACGACGACGGGGGTGACAGCGTTTTTATTTTTTTATTTTTTGTTTCGATTTTTTATTTTTCCCGTGCGGGCGGCTTAAGCGCC[C/T]
GCAGCAAAATCACGATTTTGGCAGACACCTCGTTCTAGACAGGTGGAAGATCTGCACGCAAAAACCAATTCCAACCGCATGGAAAAATTGTTAGTCTACT

Reverse complement sequence

AGTAGACTAACAATTTTTCCATGCGGTTGGAATTGGTTTTTGCGTGCAGATCTTCCACCTGTCTAGAACGAGGTGTCTGCCAAAATCGTGATTTTGCTGC[G/A]
GGCGCTTAAGCCGCCCGCACGGGAAAAATAAAAAATCGAAACAAAAAATAAAAAAATAAAAACGCTGTCACCCCCGTCGTCGTCGCCGTCTTGCCCGAGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.80% 8.60% 4.59% 0.00% NA
All Indica  2759 77.90% 14.70% 7.47% 0.00% NA
All Japonica  1512 99.80% 0.00% 0.20% 0.00% NA
Aus  269 98.10% 0.00% 1.86% 0.00% NA
Indica I  595 56.60% 23.40% 20.00% 0.00% NA
Indica II  465 95.70% 1.50% 2.80% 0.00% NA
Indica III  913 78.50% 20.00% 1.42% 0.00% NA
Indica Intermediate  786 82.60% 9.70% 7.76% 0.00% NA
Temperate Japonica  767 99.90% 0.00% 0.13% 0.00% NA
Tropical Japonica  504 99.60% 0.00% 0.40% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 94.40% 2.20% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0112504974 C -> T LOC_Os01g22249.1 upstream_gene_variant ; 4618.0bp to feature; MODIFIER silent_mutation Average:55.218; most accessible tissue: Minghui63 young leaf, score: 73.49 N N N N
vg0112504974 C -> T LOC_Os01g22230.1 downstream_gene_variant ; 759.0bp to feature; MODIFIER silent_mutation Average:55.218; most accessible tissue: Minghui63 young leaf, score: 73.49 N N N N
vg0112504974 C -> T LOC_Os01g22230.2 downstream_gene_variant ; 759.0bp to feature; MODIFIER silent_mutation Average:55.218; most accessible tissue: Minghui63 young leaf, score: 73.49 N N N N
vg0112504974 C -> T LOC_Os01g22230-LOC_Os01g22249 intergenic_region ; MODIFIER silent_mutation Average:55.218; most accessible tissue: Minghui63 young leaf, score: 73.49 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0112504974 NA 1.65E-07 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112504974 NA 4.27E-06 mr1115_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112504974 NA 7.27E-06 mr1169_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112504974 NA 2.09E-06 mr1232_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112504974 NA 1.74E-06 mr1274_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112504974 NA 3.93E-06 mr1319_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112504974 NA 1.08E-06 mr1358_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112504974 NA 1.92E-06 mr1474_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112504974 NA 9.93E-06 mr1519_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112504974 NA 2.07E-06 mr1538_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112504974 NA 1.42E-08 mr1547_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112504974 NA 5.52E-08 mr1547_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112504974 NA 5.28E-06 mr1659_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112504974 4.82E-06 4.03E-10 mr1758_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112504974 NA 7.26E-06 mr1767_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112504974 NA 1.96E-06 mr1842_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112504974 NA 1.27E-06 mr1874_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112504974 NA 9.20E-06 mr1901_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251