Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0112504974:

Variant ID: vg0112504974 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 12504974
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:

CCTCGGGCAAGACGGCGACGACGACGGGGGTGACAGCGTTTTTATTTTTTTATTTTTTGTTTCGATTTTTTATTTTTCCCGTGCGGGCGGCTTAAGCGCC[C/T]
GCAGCAAAATCACGATTTTGGCAGACACCTCGTTCTAGACAGGTGGAAGATCTGCACGCAAAAACCAATTCCAACCGCATGGAAAAATTGTTAGTCTACT

Reverse complement sequence

AGTAGACTAACAATTTTTCCATGCGGTTGGAATTGGTTTTTGCGTGCAGATCTTCCACCTGTCTAGAACGAGGTGTCTGCCAAAATCGTGATTTTGCTGC[G/A]
GGCGCTTAAGCCGCCCGCACGGGAAAAATAAAAAATCGAAACAAAAAATAAAAAAATAAAAACGCTGTCACCCCCGTCGTCGTCGCCGTCTTGCCCGAGG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.80%	8.60%	4.59%	0.00%	NA
All Indica	2759	77.90%	14.70%	7.47%	0.00%	NA
All Japonica	1512	99.80%	0.00%	0.20%	0.00%	NA
Aus	269	98.10%	0.00%	1.86%	0.00%	NA
Indica I	595	56.60%	23.40%	20.00%	0.00%	NA
Indica II	465	95.70%	1.50%	2.80%	0.00%	NA
Indica III	913	78.50%	20.00%	1.42%	0.00%	NA
Indica Intermediate	786	82.60%	9.70%	7.76%	0.00%	NA
Temperate Japonica	767	99.90%	0.00%	0.13%	0.00%	NA
Tropical Japonica	504	99.60%	0.00%	0.40%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	94.40%	2.20%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0112504974	C -> T	LOC_Os01g22249.1	upstream_gene_variant ; 4618.0bp to feature; MODIFIER	silent_mutation	Average:55.218; most accessible tissue: Minghui63 young leaf, score: 73.49	N	N	N	N
vg0112504974	C -> T	LOC_Os01g22230.1	downstream_gene_variant ; 759.0bp to feature; MODIFIER	silent_mutation	Average:55.218; most accessible tissue: Minghui63 young leaf, score: 73.49	N	N	N	N
vg0112504974	C -> T	LOC_Os01g22230.2	downstream_gene_variant ; 759.0bp to feature; MODIFIER	silent_mutation	Average:55.218; most accessible tissue: Minghui63 young leaf, score: 73.49	N	N	N	N
vg0112504974	C -> T	LOC_Os01g22230-LOC_Os01g22249	intergenic_region ; MODIFIER	silent_mutation	Average:55.218; most accessible tissue: Minghui63 young leaf, score: 73.49	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0112504974	NA	1.65E-07	mr1045_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112504974	NA	4.27E-06	mr1115_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112504974	NA	7.27E-06	mr1169_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112504974	NA	2.09E-06	mr1232_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112504974	NA	1.74E-06	mr1274_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112504974	NA	3.93E-06	mr1319_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112504974	NA	1.08E-06	mr1358_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112504974	NA	1.92E-06	mr1474_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112504974	NA	9.93E-06	mr1519_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112504974	NA	2.07E-06	mr1538_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112504974	NA	1.42E-08	mr1547_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112504974	NA	5.52E-08	mr1547_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112504974	NA	5.28E-06	mr1659_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112504974	4.82E-06	4.03E-10	mr1758_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112504974	NA	7.26E-06	mr1767_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112504974	NA	1.96E-06	mr1842_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112504974	NA	1.27E-06	mr1874_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112504974	NA	9.20E-06	mr1901_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251