\
| Variant ID: vg0112473941 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 12473941 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GTTTGGAATTTTGGATAGAAATTCCGGGCGTGACATGTTTTATGTGAATCTTAATACAAATCTAACGGTTTAAAGTTATGGATGTAATTAATTACATTGC[G/A]
TATTTATATTTGATAAATTTTTAGAGGAGAAAATTTAATTTATGGATAAATATATCATAGCAAAAATGAATCCAATTCTGTCGCGTCCGTGGGAGCCTGC
GCAGGCTCCCACGGACGCGACAGAATTGGATTCATTTTTGCTATGATATATTTATCCATAAATTAAATTTTCTCCTCTAAAAATTTATCAAATATAAATA[C/T]
GCAATGTAATTAATTACATCCATAACTTTAAACCGTTAGATTTGTATTAAGATTCACATAAAACATGTCACGCCCGGAATTTCTATCCAAAATTCCAAAC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.20% | 6.70% | 0.13% | 0.00% | NA |
| All Indica | 2759 | 96.00% | 4.00% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 97.40% | 2.60% | 0.00% | 0.00% | NA |
| Aus | 269 | 38.30% | 60.20% | 1.49% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.60% | 1.90% | 0.43% | 0.00% | NA |
| Indica III | 913 | 95.10% | 4.90% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 93.00% | 7.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 92.50% | 7.50% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0112473941 | G -> A | LOC_Os01g22190.1 | upstream_gene_variant ; 312.0bp to feature; MODIFIER | silent_mutation | Average:38.204; most accessible tissue: Callus, score: 53.498 | N | N | N | N |
| vg0112473941 | G -> A | LOC_Os01g22180.1 | downstream_gene_variant ; 3071.0bp to feature; MODIFIER | silent_mutation | Average:38.204; most accessible tissue: Callus, score: 53.498 | N | N | N | N |
| vg0112473941 | G -> A | LOC_Os01g22180-LOC_Os01g22190 | intergenic_region ; MODIFIER | silent_mutation | Average:38.204; most accessible tissue: Callus, score: 53.498 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0112473941 | NA | 3.62E-08 | mr1230 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112473941 | NA | 5.95E-06 | mr1393 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112473941 | 9.82E-06 | NA | mr1410 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112473941 | NA | 4.38E-06 | mr1424 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112473941 | NA | 3.26E-06 | mr1665 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112473941 | NA | 5.95E-07 | mr1654_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112473941 | NA | 7.08E-12 | mr1803_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112473941 | NA | 5.60E-07 | mr1808_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |