\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0112473941:

Variant ID: vg0112473941 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 12473941
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTTTGGAATTTTGGATAGAAATTCCGGGCGTGACATGTTTTATGTGAATCTTAATACAAATCTAACGGTTTAAAGTTATGGATGTAATTAATTACATTGC[G/A]
TATTTATATTTGATAAATTTTTAGAGGAGAAAATTTAATTTATGGATAAATATATCATAGCAAAAATGAATCCAATTCTGTCGCGTCCGTGGGAGCCTGC

Reverse complement sequence

GCAGGCTCCCACGGACGCGACAGAATTGGATTCATTTTTGCTATGATATATTTATCCATAAATTAAATTTTCTCCTCTAAAAATTTATCAAATATAAATA[C/T]
GCAATGTAATTAATTACATCCATAACTTTAAACCGTTAGATTTGTATTAAGATTCACATAAAACATGTCACGCCCGGAATTTCTATCCAAAATTCCAAAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.20% 6.70% 0.13% 0.00% NA
All Indica  2759 96.00% 4.00% 0.07% 0.00% NA
All Japonica  1512 97.40% 2.60% 0.00% 0.00% NA
Aus  269 38.30% 60.20% 1.49% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 97.60% 1.90% 0.43% 0.00% NA
Indica III  913 95.10% 4.90% 0.00% 0.00% NA
Indica Intermediate  786 93.00% 7.00% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 92.50% 7.50% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 94.40% 5.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0112473941 G -> A LOC_Os01g22190.1 upstream_gene_variant ; 312.0bp to feature; MODIFIER silent_mutation Average:38.204; most accessible tissue: Callus, score: 53.498 N N N N
vg0112473941 G -> A LOC_Os01g22180.1 downstream_gene_variant ; 3071.0bp to feature; MODIFIER silent_mutation Average:38.204; most accessible tissue: Callus, score: 53.498 N N N N
vg0112473941 G -> A LOC_Os01g22180-LOC_Os01g22190 intergenic_region ; MODIFIER silent_mutation Average:38.204; most accessible tissue: Callus, score: 53.498 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0112473941 NA 3.62E-08 mr1230 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112473941 NA 5.95E-06 mr1393 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112473941 9.82E-06 NA mr1410 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112473941 NA 4.38E-06 mr1424 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112473941 NA 3.26E-06 mr1665 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112473941 NA 5.95E-07 mr1654_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112473941 NA 7.08E-12 mr1803_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112473941 NA 5.60E-07 mr1808_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251