\
| Variant ID: vg0112458126 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 12458126 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
AAATCCTCTAGTCTCTCTCTGTCCTGCTGCTTCATTTATCGCCAAAATCTGACCTTTAAAATGTTGCTTTTCTTTTTGTTTTTGTTTGTAGATGGCCGGC[A/C]
GCGTCAGCCATCGTGGTCTGGACATGACTGGTTTCGTCTTGGAGCTGCGGGGCATGTGCGTTGTCCTGGGGTATCCGCATGGAGTGGACTACCAGGGCAG
CTGCCCTGGTAGTCCACTCCATGCGGATACCCCAGGACAACGCACATGCCCCGCAGCTCCAAGACGAAACCAGTCATGTCCAGACCACGATGGCTGACGC[T/G]
GCCGGCCATCTACAAACAAAAACAAAAAGAAAAGCAACATTTTAAAGGTCAGATTTTGGCGATAAATGAAGCAGCAGGACAGAGAGAGACTAGAGGATTT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 28.40% | 5.10% | 23.66% | 42.87% | NA |
| All Indica | 2759 | 3.30% | 1.90% | 27.94% | 66.87% | NA |
| All Japonica | 1512 | 78.20% | 9.50% | 5.56% | 6.75% | NA |
| Aus | 269 | 3.30% | 0.40% | 80.67% | 15.61% | NA |
| Indica I | 595 | 3.50% | 0.00% | 15.97% | 80.50% | NA |
| Indica II | 465 | 4.70% | 1.70% | 18.06% | 75.48% | NA |
| Indica III | 913 | 2.20% | 3.40% | 37.57% | 56.85% | NA |
| Indica Intermediate | 786 | 3.60% | 1.70% | 31.68% | 63.10% | NA |
| Temperate Japonica | 767 | 91.10% | 1.00% | 4.30% | 3.52% | NA |
| Tropical Japonica | 504 | 60.10% | 24.40% | 7.94% | 7.54% | NA |
| Japonica Intermediate | 241 | 75.10% | 5.00% | 4.56% | 15.35% | NA |
| VI/Aromatic | 96 | 28.10% | 37.50% | 22.92% | 11.46% | NA |
| Intermediate | 90 | 36.70% | 7.80% | 26.67% | 28.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0112458126 | A -> DEL | LOC_Os01g22170.1 | N | frameshift_variant | Average:13.284; most accessible tissue: Zhenshan97 panicle, score: 20.424 | N | N | N | N |
| vg0112458126 | A -> C | LOC_Os01g22170.1 | missense_variant ; p.Ser56Arg; MODERATE | nonsynonymous_codon ; S56R | Average:13.284; most accessible tissue: Zhenshan97 panicle, score: 20.424 | possibly damaging |
1.871 |
DELETERIOUS | 0.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0112458126 | NA | 4.87E-07 | mr1125 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112458126 | NA | 2.45E-08 | mr1136 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112458126 | NA | 4.21E-08 | mr1188 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112458126 | 8.44E-08 | 1.17E-09 | mr1448 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112458126 | 1.01E-06 | 5.61E-09 | mr1125_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112458126 | NA | 7.19E-10 | mr1188_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |