\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0112449676:

Variant ID: vg0112449676 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 12449676
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.02, others allele: 0.00, population size: 53. )

Flanking Sequence (100 bp) in Reference Genome:


GGTTTCTTAGTCACTTTTCCAAATTCACAAACAATTTTCTCTGTCATTGCACACACCTTTTCTTCTGAGGTTGGTTTGGGTGCAAGATCAGTGTCACGCC[T/C]
GGAATTTCTATCCAAAATTCCAAACGCTTACATGTGTGTGAACCCTCGTCCAGGAATCAGCCGAGGCACACAATAACAAATTGATAATAGAGTACAAATA

Reverse complement sequence

TATTTGTACTCTATTATCAATTTGTTATTGTGTGCCTCGGCTGATTCCTGGACGAGGGTTCACACACATGTAAGCGTTTGGAATTTTGGATAGAAATTCC[A/G]
GGCGTGACACTGATCTTGCACCCAAACCAACCTCAGAAGAAAAGGTGTGTGCAATGACAGAGAAAATTGTTTGTGAATTTGGAAAAGTGACTAAGAAACC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 26.50% 4.90% 13.37% 55.23% NA
All Indica  2759 4.70% 0.10% 14.46% 80.72% NA
All Japonica  1512 67.30% 15.00% 6.22% 11.51% NA
Aus  269 0.70% 0.00% 45.72% 53.53% NA
Indica I  595 3.00% 0.00% 3.53% 93.45% NA
Indica II  465 5.80% 0.00% 4.73% 89.46% NA
Indica III  913 5.90% 0.10% 23.66% 70.32% NA
Indica Intermediate  786 4.10% 0.10% 17.81% 77.99% NA
Temperate Japonica  767 74.70% 16.00% 3.78% 5.48% NA
Tropical Japonica  504 66.50% 14.10% 5.75% 13.69% NA
Japonica Intermediate  241 45.20% 13.70% 14.94% 26.14% NA
VI/Aromatic  96 68.80% 0.00% 0.00% 31.25% NA
Intermediate  90 41.10% 2.20% 17.78% 38.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0112449676 T -> DEL N N silent_mutation Average:10.364; most accessible tissue: Callus, score: 18.564 N N N N
vg0112449676 T -> C LOC_Os01g22150.1 upstream_gene_variant ; 3526.0bp to feature; MODIFIER silent_mutation Average:10.364; most accessible tissue: Callus, score: 18.564 N N N N
vg0112449676 T -> C LOC_Os01g22150-LOC_Os01g22170 intergenic_region ; MODIFIER silent_mutation Average:10.364; most accessible tissue: Callus, score: 18.564 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0112449676 NA 2.01E-06 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112449676 2.82E-06 NA mr1034 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112449676 NA 3.22E-07 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112449676 NA 1.77E-06 mr1170 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112449676 NA 5.27E-08 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112449676 NA 3.40E-08 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112449676 NA 5.03E-06 mr1280 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112449676 NA 6.67E-06 mr1418 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112449676 NA 2.68E-07 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112449676 NA 3.65E-07 mr1622 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112449676 NA 7.78E-06 mr1794 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112449676 NA 9.65E-06 mr1851 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112449676 9.25E-06 NA mr1864 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112449676 NA 5.83E-06 mr1906 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112449676 NA 8.15E-06 mr1960 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112449676 NA 4.94E-13 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251