\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0112359307:

Variant ID: vg0112359307 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 12359307
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTCGTTGCTGTTATAACGTGTCTATCGATGTTATAGTATGCTAATTATATTTAGATTATGGTGTTATAATATATGGATAAGCATTTTTCTATAGGTTTTA[C/T]
CGAAAGTCGTCGGTGACACCGACACCGACGCTTTATACTGTAGATCCGCCACTGAACCTCATTGGCTGCCACGAATAGCTAGCAGGTGGTGGCGCCTCGG

Reverse complement sequence

CCGAGGCGCCACCACCTGCTAGCTATTCGTGGCAGCCAATGAGGTTCAGTGGCGGATCTACAGTATAAAGCGTCGGTGTCGGTGTCACCGACGACTTTCG[G/A]
TAAAACCTATAGAAAAATGCTTATCCATATATTATAACACCATAATCTAAATATAATTAGCATACTATAACATCGATAGACACGTTATAACAGCAACGAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.70% 10.20% 0.04% 0.00% NA
All Indica  2759 89.10% 10.80% 0.04% 0.00% NA
All Japonica  1512 99.70% 0.30% 0.00% 0.00% NA
Aus  269 36.80% 63.20% 0.00% 0.00% NA
Indica I  595 99.30% 0.70% 0.00% 0.00% NA
Indica II  465 95.10% 4.90% 0.00% 0.00% NA
Indica III  913 83.40% 16.60% 0.00% 0.00% NA
Indica Intermediate  786 84.60% 15.30% 0.13% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 86.70% 12.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0112359307 C -> T LOC_Os01g22010.1 downstream_gene_variant ; 4402.0bp to feature; MODIFIER silent_mutation Average:89.456; most accessible tissue: Callus, score: 94.689 N N N N
vg0112359307 C -> T LOC_Os01g22010.2 downstream_gene_variant ; 4402.0bp to feature; MODIFIER silent_mutation Average:89.456; most accessible tissue: Callus, score: 94.689 N N N N
vg0112359307 C -> T LOC_Os01g22010.3 downstream_gene_variant ; 4402.0bp to feature; MODIFIER silent_mutation Average:89.456; most accessible tissue: Callus, score: 94.689 N N N N
vg0112359307 C -> T LOC_Os01g22010.4 downstream_gene_variant ; 4402.0bp to feature; MODIFIER silent_mutation Average:89.456; most accessible tissue: Callus, score: 94.689 N N N N
vg0112359307 C -> T LOC_Os01g22000-LOC_Os01g22010 intergenic_region ; MODIFIER silent_mutation Average:89.456; most accessible tissue: Callus, score: 94.689 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0112359307 C T 0.06 0.06 0.03 -0.01 0.0 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0112359307 NA 4.27E-07 mr1126 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112359307 NA 1.00E-13 mr1166 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112359307 NA 9.10E-06 mr1349 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112359307 NA 8.29E-06 mr1424 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112359307 NA 7.48E-19 mr1515 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112359307 NA 1.17E-06 mr1556 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112359307 NA 1.67E-06 mr1587 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112359307 NA 1.93E-06 mr1634 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112359307 NA 3.07E-06 mr1665 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112359307 NA 6.10E-06 mr1774 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112359307 NA 2.27E-06 mr1787 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112359307 NA 1.27E-10 mr1510_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112359307 NA 2.45E-09 mr1582_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112359307 NA 3.18E-22 mr1587_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112359307 1.82E-06 2.96E-10 mr1654_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112359307 NA 1.08E-07 mr1792_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112359307 NA 1.61E-14 mr1803_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112359307 NA 4.39E-07 mr1808_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251