\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0112354516:

Variant ID: vg0112354516 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 12354516
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 115. )

Flanking Sequence (100 bp) in Reference Genome:


TTTTTATAATTAGTATTTTTATTATTATTAGATGATAGAACATAAATAATACTTTATATGTGACTATTTTTTTATAAATTTTTTAAATAAGATGGATAGT[C/T]
AAATATTGGACACGGATACCCACGGCTGCACTTATTTTAGAACGGAGATAGTGTCTATTATTTTTTTCAAACTCTTTTAAATTTGAAATTTTCTGAACCA

Reverse complement sequence

TGGTTCAGAAAATTTCAAATTTAAAAGAGTTTGAAAAAAATAATAGACACTATCTCCGTTCTAAAATAAGTGCAGCCGTGGGTATCCGTGTCCAATATTT[G/A]
ACTATCCATCTTATTTAAAAAATTTATAAAAAAATAGTCACATATAAAGTATTATTTATGTTCTATCATCTAATAATAATAAAAATACTAATTATAAAAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.80% 13.10% 0.15% 0.00% NA
All Indica  2759 84.00% 15.80% 0.22% 0.00% NA
All Japonica  1512 99.80% 0.20% 0.00% 0.00% NA
Aus  269 36.40% 63.60% 0.00% 0.00% NA
Indica I  595 93.60% 6.20% 0.17% 0.00% NA
Indica II  465 91.40% 8.60% 0.00% 0.00% NA
Indica III  913 80.10% 19.70% 0.22% 0.00% NA
Indica Intermediate  786 77.00% 22.60% 0.38% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 88.90% 10.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0112354516 C -> T LOC_Os01g22000.1 upstream_gene_variant ; 1453.0bp to feature; MODIFIER silent_mutation Average:73.749; most accessible tissue: Callus, score: 92.715 N N N N
vg0112354516 C -> T LOC_Os01g21990.1 downstream_gene_variant ; 3283.0bp to feature; MODIFIER silent_mutation Average:73.749; most accessible tissue: Callus, score: 92.715 N N N N
vg0112354516 C -> T LOC_Os01g22000-LOC_Os01g22010 intergenic_region ; MODIFIER silent_mutation Average:73.749; most accessible tissue: Callus, score: 92.715 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0112354516 NA 1.67E-06 mr1209 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112354516 NA 1.43E-08 mr1230 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112354516 NA 2.73E-10 mr1232 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112354516 NA 8.68E-06 mr1280 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112354516 NA 5.70E-06 mr1314 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112354516 NA 1.80E-06 mr1365 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112354516 NA 2.78E-06 mr1393 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112354516 NA 1.35E-08 mr1424 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112354516 NA 4.04E-06 mr1474 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112354516 NA 4.04E-06 mr1475 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112354516 NA 5.53E-06 mr1523 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112354516 NA 6.39E-06 mr1544 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112354516 NA 6.08E-07 mr1556 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112354516 NA 1.41E-06 mr1574 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112354516 NA 3.09E-06 mr1665 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112354516 NA 6.14E-06 mr1774 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112354516 NA 3.91E-06 mr1787 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112354516 NA 8.15E-06 mr1820 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112354516 NA 6.54E-09 mr1939 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251