\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0112321732:

Variant ID: vg0112321732 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 12321732
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:


TTCATATTGTATTTTATATACATGTTAGTTATTAATTATTTTTAATATCAAATTTTAGTTATTTGTAAATTATATATATTCCTATATGGACTATAGACTC[A/G]
TCTTTTAATATTTCTTTTTTTTAATTCTGAATTTTTATTATTTCTAATTGTATTTCTATGTGGACTCTAAACTCATCTTTCAATATTCTTTAATTTTTAA

Reverse complement sequence

TTAAAAATTAAAGAATATTGAAAGATGAGTTTAGAGTCCACATAGAAATACAATTAGAAATAATAAAAATTCAGAATTAAAAAAAAGAAATATTAAAAGA[T/C]
GAGTCTATAGTCCATATAGGAATATATATAATTTACAAATAACTAAAATTTGATATTAAAAATAATTAATAACTAACATGTATATAAAATACAATATGAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 42.20% 34.30% 13.80% 9.75% NA
All Indica  2759 57.60% 5.80% 21.02% 15.59% NA
All Japonica  1512 8.70% 89.50% 1.46% 0.33% NA
Aus  269 79.90% 1.10% 11.90% 7.06% NA
Indica I  595 37.80% 0.80% 45.55% 15.80% NA
Indica II  465 47.50% 8.40% 20.65% 23.44% NA
Indica III  913 72.30% 7.90% 8.43% 11.39% NA
Indica Intermediate  786 61.60% 5.50% 17.30% 15.65% NA
Temperate Japonica  767 2.50% 97.00% 0.52% 0.00% NA
Tropical Japonica  504 14.70% 81.30% 3.17% 0.79% NA
Japonica Intermediate  241 16.20% 82.60% 0.83% 0.41% NA
VI/Aromatic  96 25.00% 65.60% 6.25% 3.12% NA
Intermediate  90 35.60% 46.70% 13.33% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0112321732 A -> G LOC_Os01g21960.1 upstream_gene_variant ; 4754.0bp to feature; MODIFIER silent_mutation Average:20.95; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N
vg0112321732 A -> G LOC_Os01g21950.1 downstream_gene_variant ; 4471.0bp to feature; MODIFIER silent_mutation Average:20.95; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N
vg0112321732 A -> G LOC_Os01g21950-LOC_Os01g21960 intergenic_region ; MODIFIER silent_mutation Average:20.95; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N
vg0112321732 A -> DEL N N silent_mutation Average:20.95; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0112321732 6.25E-07 6.25E-07 mr1008 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112321732 1.12E-06 1.12E-06 mr1009 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112321732 NA 1.54E-68 mr1014 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112321732 NA 1.76E-19 mr1021 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112321732 NA 6.42E-14 mr1032 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112321732 7.25E-06 4.91E-18 mr1114 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112321732 8.22E-07 1.05E-08 mr1114 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112321732 NA 5.05E-18 mr1116 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112321732 NA 1.91E-06 mr1116 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112321732 NA 2.03E-06 mr1117 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112321732 NA 9.67E-15 mr1118 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112321732 NA 2.27E-06 mr1118 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112321732 9.80E-06 1.12E-06 mr1123 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112321732 NA 2.34E-44 mr1152 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112321732 NA 1.35E-16 mr1165 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112321732 7.92E-07 1.22E-22 mr1242 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112321732 2.38E-07 3.66E-08 mr1242 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112321732 NA 3.47E-06 mr1247 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112321732 NA 6.55E-16 mr1276 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112321732 NA 1.48E-16 mr1324 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112321732 NA 1.08E-10 mr1325 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112321732 NA 4.28E-13 mr1335 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112321732 NA 2.09E-14 mr1478 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112321732 NA 2.15E-11 mr1553 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112321732 NA 3.09E-08 mr1660 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112321732 NA 1.75E-62 mr1695 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112321732 NA 7.29E-07 mr1695 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112321732 NA 1.57E-21 mr1698 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112321732 NA 5.05E-07 mr1781 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112321732 NA 3.84E-25 mr1917 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112321732 4.08E-06 3.26E-07 mr1917 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112321732 NA 6.90E-06 mr1961 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251