\
| Variant ID: vg0112215171 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 12215171 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.92, T: 0.08, others allele: 0.00, population size: 103. )
TCTAGTTACTTGATATATATTAATATTTGGAAAAATGTCTTTACATCATTTTAAATGCCTTAAGAAAATGCCTTTACATATGAAGCAAATTTTAAAGTGC[C/T]
GAAAAGATGTCTCTATAAGATAAATTTAACAAAGTATGCTAAAAATGTCTCTAAAGTGTCTCTAGAGTAAAAATATTTTAGGCGATTTTGAAAGTGCCTC
GAGGCACTTTCAAAATCGCCTAAAATATTTTTACTCTAGAGACACTTTAGAGACATTTTTAGCATACTTTGTTAAATTTATCTTATAGAGACATCTTTTC[G/A]
GCACTTTAAAATTTGCTTCATATGTAAAGGCATTTTCTTAAGGCATTTAAAATGATGTAAAGACATTTTTCCAAATATTAATATATATCAAGTAACTAGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 77.20% | 18.00% | 1.95% | 2.86% | NA |
| All Indica | 2759 | 71.10% | 27.40% | 1.41% | 0.07% | NA |
| All Japonica | 1512 | 87.80% | 0.40% | 3.11% | 8.73% | NA |
| Aus | 269 | 71.40% | 27.90% | 0.74% | 0.00% | NA |
| Indica I | 595 | 93.60% | 6.20% | 0.17% | 0.00% | NA |
| Indica II | 465 | 81.50% | 17.20% | 1.08% | 0.22% | NA |
| Indica III | 913 | 55.60% | 42.60% | 1.75% | 0.00% | NA |
| Indica Intermediate | 786 | 65.90% | 31.80% | 2.16% | 0.13% | NA |
| Temperate Japonica | 767 | 90.10% | 0.40% | 4.30% | 5.22% | NA |
| Tropical Japonica | 504 | 80.40% | 0.60% | 2.38% | 16.67% | NA |
| Japonica Intermediate | 241 | 95.90% | 0.00% | 0.83% | 3.32% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 78.90% | 15.60% | 4.44% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0112215171 | C -> T | LOC_Os01g21760.1 | downstream_gene_variant ; 4358.0bp to feature; MODIFIER | silent_mutation | Average:18.595; most accessible tissue: Zhenshan97 flower, score: 25.055 | N | N | N | N |
| vg0112215171 | C -> T | LOC_Os01g21760-LOC_Os01g21780 | intergenic_region ; MODIFIER | silent_mutation | Average:18.595; most accessible tissue: Zhenshan97 flower, score: 25.055 | N | N | N | N |
| vg0112215171 | C -> DEL | N | N | silent_mutation | Average:18.595; most accessible tissue: Zhenshan97 flower, score: 25.055 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0112215171 | 1.56E-06 | 6.20E-07 | mr1071 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112215171 | 2.92E-06 | 4.84E-07 | mr1080 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112215171 | 7.37E-07 | 3.76E-07 | mr1140 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112215171 | 4.08E-06 | 5.54E-07 | mr1203 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112215171 | 7.56E-07 | 1.06E-07 | mr1395 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112215171 | 9.26E-06 | 8.06E-08 | mr1613 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112215171 | 8.52E-07 | 8.61E-08 | mr1618 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112215171 | NA | 2.18E-06 | mr1619 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0112215171 | 8.12E-06 | NA | mr1080_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |