\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0112215171:

Variant ID: vg0112215171 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 12215171
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.92, T: 0.08, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


TCTAGTTACTTGATATATATTAATATTTGGAAAAATGTCTTTACATCATTTTAAATGCCTTAAGAAAATGCCTTTACATATGAAGCAAATTTTAAAGTGC[C/T]
GAAAAGATGTCTCTATAAGATAAATTTAACAAAGTATGCTAAAAATGTCTCTAAAGTGTCTCTAGAGTAAAAATATTTTAGGCGATTTTGAAAGTGCCTC

Reverse complement sequence

GAGGCACTTTCAAAATCGCCTAAAATATTTTTACTCTAGAGACACTTTAGAGACATTTTTAGCATACTTTGTTAAATTTATCTTATAGAGACATCTTTTC[G/A]
GCACTTTAAAATTTGCTTCATATGTAAAGGCATTTTCTTAAGGCATTTAAAATGATGTAAAGACATTTTTCCAAATATTAATATATATCAAGTAACTAGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.20% 18.00% 1.95% 2.86% NA
All Indica  2759 71.10% 27.40% 1.41% 0.07% NA
All Japonica  1512 87.80% 0.40% 3.11% 8.73% NA
Aus  269 71.40% 27.90% 0.74% 0.00% NA
Indica I  595 93.60% 6.20% 0.17% 0.00% NA
Indica II  465 81.50% 17.20% 1.08% 0.22% NA
Indica III  913 55.60% 42.60% 1.75% 0.00% NA
Indica Intermediate  786 65.90% 31.80% 2.16% 0.13% NA
Temperate Japonica  767 90.10% 0.40% 4.30% 5.22% NA
Tropical Japonica  504 80.40% 0.60% 2.38% 16.67% NA
Japonica Intermediate  241 95.90% 0.00% 0.83% 3.32% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 78.90% 15.60% 4.44% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0112215171 C -> T LOC_Os01g21760.1 downstream_gene_variant ; 4358.0bp to feature; MODIFIER silent_mutation Average:18.595; most accessible tissue: Zhenshan97 flower, score: 25.055 N N N N
vg0112215171 C -> T LOC_Os01g21760-LOC_Os01g21780 intergenic_region ; MODIFIER silent_mutation Average:18.595; most accessible tissue: Zhenshan97 flower, score: 25.055 N N N N
vg0112215171 C -> DEL N N silent_mutation Average:18.595; most accessible tissue: Zhenshan97 flower, score: 25.055 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0112215171 1.56E-06 6.20E-07 mr1071 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112215171 2.92E-06 4.84E-07 mr1080 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112215171 7.37E-07 3.76E-07 mr1140 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112215171 4.08E-06 5.54E-07 mr1203 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112215171 7.56E-07 1.06E-07 mr1395 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112215171 9.26E-06 8.06E-08 mr1613 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112215171 8.52E-07 8.61E-08 mr1618 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112215171 NA 2.18E-06 mr1619 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112215171 8.12E-06 NA mr1080_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251