Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0112192551:

Variant ID: vg0112192551 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 12192551
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 120. )

Flanking Sequence (100 bp) in Reference Genome:

TTGTACCGTATACATGGAAGTTATTTTTTTAATTAAAAATAGATCTAATCTGATGATGTGAAATATCGGGTCCACTATAATTTTAGTGATGAAAATCAAC[G/A]
GTGAGATTAGACAGTGCCACGTGGCGGCCTAAGAGTGTTTATATGAGTGCCACGTGGTGGCTTGAGAGTGATTGTAGGAAAGTTAATGGACTTTTAGTAT

Reverse complement sequence

ATACTAAAAGTCCATTAACTTTCCTACAATCACTCTCAAGCCACCACGTGGCACTCATATAAACACTCTTAGGCCGCCACGTGGCACTGTCTAATCTCAC[C/T]
GTTGATTTTCATCACTAAAATTATAGTGGACCCGATATTTCACATCATCAGATTAGATCTATTTTTAATTAAAAAAATAACTTCCATGTATACGGTACAA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	51.70%	43.10%	0.61%	4.57%	NA
All Indica	2759	71.40%	27.00%	0.36%	1.20%	NA
All Japonica	1512	5.80%	81.20%	1.12%	11.90%	NA
Aus	269	98.90%	1.10%	0.00%	0.00%	NA
Indica I	595	91.10%	8.60%	0.34%	0.00%	NA
Indica II	465	75.70%	21.10%	0.43%	2.80%	NA
Indica III	913	60.50%	38.70%	0.33%	0.55%	NA
Indica Intermediate	786	66.80%	30.90%	0.38%	1.91%	NA
Temperate Japonica	767	1.80%	88.50%	0.91%	8.74%	NA
Tropical Japonica	504	13.50%	64.10%	1.98%	20.44%	NA
Japonica Intermediate	241	2.10%	93.80%	0.00%	4.15%	NA
VI/Aromatic	96	78.10%	21.90%	0.00%	0.00%	NA
Intermediate	90	50.00%	44.40%	2.22%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0112192551	G -> A	LOC_Os01g21720.1	upstream_gene_variant ; 3208.0bp to feature; MODIFIER	silent_mutation	Average:39.6; most accessible tissue: Zhenshan97 young leaf, score: 61.386	N	N	N	N
vg0112192551	G -> A	LOC_Os01g21720-LOC_Os01g21730	intergenic_region ; MODIFIER	silent_mutation	Average:39.6; most accessible tissue: Zhenshan97 young leaf, score: 61.386	N	N	N	N
vg0112192551	G -> DEL	N	N	silent_mutation	Average:39.6; most accessible tissue: Zhenshan97 young leaf, score: 61.386	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0112192551	NA	2.84E-07	mr1193	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112192551	1.88E-06	2.37E-07	mr1448	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112192551	NA	1.29E-13	mr1874	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112192551	NA	5.24E-06	mr1892	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251